WRKY transcription factors have been extensively characterized in the past 20 years, but in wheat, studies on WRKY genes and their function are lagging behind many other species. To explore the function of wheat WRKY genes, we identified a TaWRKY68 gene from a common wheat cultivar. It encodes a protein comprising 313 amino acids which harbors 19 conserved motifs or active sites. Gene expression patterns were determined by analyzing microarray data of TaWRKY68 in wheat and of orthologous genes from maize, rice and barley using Genevestigator. TaWRKY68 orthologs were identified and clustered using DELTA-BLAST and COBALT programs available at NCBI. The results showed that these genes, which are expressed in all tissues tested, had relatively higher levels in the roots and were up-regulated in response to biotic stresses. Bioinformatics results were confirmed by RT-PCR experiments using wheat plants infected by Agrobacterium tumefaciens and Blumeria graminis, or treated with Deoxynivalenol, a Fusarium graminearum-induced mycotoxin in wheat or barley. In summary, TaWRKY68 functions differ during plant developmental stages and might be representing a hub gene function in wheat responses to various biotic stresses. It was also found that including data from major cereal genes in the bioinformatics analysis gave more accurate and comprehensive predictions of wheat gene functions.

Prostate cancer (PCa) is the most commonly diagnosed malignancy and the second leading cause of cancer related death in men. The early diagnosis and treatment of PCa are still challenging due to the lack of efficient tumor targeting agents in traditional managements. Prostate specific membrane antigen (PSMA) is highly expressed in PCa, while only has limited expression in other organs, providing an ideal target for the diagnosis and therapy of PCa. The antibody library technique has opened the avenue for the discovery of novel antibodies to be used in the diagnosis and therapy of cancer. In this paper, by screening a large yeast display naive human single chain antibody fragment (scFv) library, we obtained a high affinity scFv targeting PSMA, called gy1. The gy1 scFv was expressed in E.coli and purified via a C terminal 6His tag. The binding affinity of gy1 was shown to be at the nanomolar level and gy1 can specifically bind with PSMA positive cancer cells, and binding triggers its rapid internalization through the endosome-lysosome pathway. The specific targeting of gy1 to PSMA positive tumor tissues was also evaluated in vivo. We showed that the IRDye800CW labeled gy1 can efficiently target and specifically distribute in PSMA positive tumor tissues after being injected into xenograft nude mice. This study indicated that the novel antibody gy1 could be used as a great tool for the development of PSMA targeted imaging and therapy agents for PCa.

Breast cancer brain metastases (BCBMs) are common in patients with metastatic breast cancer and indicate a poor prognosis. These tumors are especially resistant to currently available treatments due to multiple factors. However, the combination of chimeric antigen receptor (CAR)-modified immune cells and oncolytic herpes simplex virus (oHSV) has not yet been explored in this context. In this study, NK-92 cells and primary NK cells were engineered to express the second generation of EGFR-CAR. The efficacies of anti-BCBMs of EGFR-CAR NK cells, oHSV-1, and their combination were tested in vitro and in a breast cancer intracranial mouse model. In vitro, compared with mock-transduced NK-92 cells or primary NK cells, EGFR-CAR-engineered NK-92 cells and primary NK cells displayed enhanced cytotoxicity and IFN-γ production when co-cultured with breast cancer cell lines MDA-MB-231, MDA-MB-468, and MCF-7. oHSV-1 alone was also capable of lysing and destroying these cells. However, a higher cytolytic effect of EGFR-CAR NK-92 cells was observed when combined with oHSV-1 compared to the monotherapies. In the mice intracranially pre-inoculated with EGFR-expressing MDA-MB-231 cells, intratumoral administration of either EGFR-CAR-transduced NK-92 cells or oHSV-1 mitigated tumor growth. Notably, the combination of EGFR-CAR NK-92 cells with oHSV-1 resulted in more efficient killing of MDA-MB-231 tumor cells and significantly longer survival of tumor-bearing mice when compared to monotherapies. These results demonstrate that regional administration of EGFR-CAR NK-92 cells combined with oHSV-1 therapy is a potentially promising strategy to treat BCBMs.

In Escherichia coli, 12 distinct RNA structures within the transcripts encoding ribosomal proteins interact with specific ribosomal proteins to allow autogenous regulation of expression from large multi-gene operons, thus coordinating ribosomal protein biosynthesis across multiple operons. However, these RNA structures are typically not represented in the RNA Families Database or annotated in genomic sequences databases, and their phylogenetic distribution is largely unknown. To investigate the extent to which these RNA structures are conserved across eubacterial phyla, we created multiple sequence alignments representing 10 of these messenger RNA (mRNA) structures in E. coli. We find that while three RNA structures are widely distributed across many phyla of bacteria, seven of the RNAs are narrowly distributed to a few orders of Gammaproteobacteria. To experimentally validate our computational predictions, we biochemically confirmed dual L1-binding sites identified in many Firmicute species. This work reveals that RNA-based regulation of ribosomal protein biosynthesis is used in nearly all eubacterial phyla, but the specific RNA structures that regulate ribosomal protein biosynthesis in E. coli are narrowly distributed. These results highlight the limits of our knowledge regarding ribosomal protein biosynthesis regulation outside of E. coli, and the potential for alternative RNA structures responsible for regulating ribosomal proteins in other eubacteria.

Connexin 43 (Cx43) widely exists in all components of the neurovascular unit (NVU) and is a constituent of gap junctions and hemichannels. In physiological states, gap junctions are open for regular intercellular communication, and the hemichannels present low open probability in astrocytes. After cerebral ischemia, a large number of hemichannels are unusually opened, leading to cell swelling and even death. Most known hemichannel blockers also inhibit gap junctions and sequentially obstruct normal electrical cell-cell communication. In this study, we tested the hypothesis that Gap19, a selective Cx43-hemichannel inhibitor, exhibited neuroprotective effects on cerebral ischemia/reperfusion (I/R). An obvious improvement in neurological scores and infarct volume reduction were observed in Gap19-treated mice after brain ischemia induced by middle cerebral artery occlusion (MCAO). Gap19 treatment attenuated white matter damage. Moreover, Gap19 treatment suppressed the expression of Cx43 and Toll-like receptor 4 (TLR4) pathway-relevant proteins and prevented the overexpression of tumour necrosis factor-α (TNF-α) and interleukin-1β (IL-1β). To further explore downstream signaling, we established an in vitro model-oxygen glucose deprivation (OGD) to simulate ischemic conditions. Immunofluorescence staining showed that Cx43 co-existed with TLR4 in astrocytes. The hemichannel activity was increased after OGD and Gap19 could inhibit this effect on astrocytes. Gap19 substantially improved relative cell vitality and decreased the expression of Cx43, TLR4 and inflammatory cytokines in vitro. In addition, in the lipopolysaccharide (LPS) stimulation OGD model, Gap19 also exhibited a protective effect via inhibiting TLR4 pathway activation. In summary, our results showed that Gap19 exerted a neuroprotective effect after stroke via inhibition of the TLR4-mediated signaling pathway.

Purified vitexin compound 1 (VB1, a neolignan isolated and extracted from the seed of Chinese herb Vitex negundo) is an effective antitumor agent and exhibits promising clinical activity against various cancers including colorectal cancer. However, it remains unknown about the precise underlying mechanism associated with the antitumor effect of VB1 and how it triggers apoptosis in cancer cells. Here, we demonstrated that VB1 promoted apoptosis via p53-dependent induction of p53 upregulated modulator of apoptosis (PUMA) and further to induce Bax (Bcl-2-associated X protein) activation and mitochondrial dysfunction in colon cancer HCT-116 and LoVo cells. Deficiency in p53, PUMA, or Bax abrogated VB1-induced apoptosis and promoted cell survival in HCT-116 cells. Furthermore, the combination of VB1 with chemotherapeutic drugs 5-fluorouracil (5-FU) or NVP-BZE235 resulted in a synergistic antitumor effect via PUMA induction in HCT-116 cells. VB1 significantly suppressed the cell proliferation of wild-type (WT) HCT-116 and LoVo cells in vitro and tumor growth in vivo. The results indicate that p53/PUMA/Bax axis plays a critical role in VB1-induced apoptosis and VB1 may have valuable clinical applications in cancer therapy as a novel anticancer agent used alone or in combination with other chemotherapeutic drugs.

The expression of secreted protein acidic and rich in cysteine (SPARC) has been recently identified to be associated with the pathology of diabetic retinopathy. Therefore, the present study aimed to evaluate the regulatory role of SPARC in human retinal capillary endothelial cells (HRCECs), following exposure to a high glucose environment in vitro. The cell viability, migration, angiogenesis, permeability and SPARC expression levels of HRCECs were measured following treatment with different concentrations of glucose (25, 50 or 100 mM). Lentiviral vectors (LV185-pL_shRNA_mKate2-SPARC-543; target sequence, GGATGAGGACAACAACCTTCT) that inhibit the expression of SPARC were constructed, and HRCECs were evaluated when infected by viruses carrying the lentiviral vectors. Cell viability was examined using the Cell Counting Kit-8 assay. The expression of SPARC in HRCECs increased as the concentration of glucose in the culture medium increased. Relatively high concentrations of glucose significantly inhibited cell proliferation (P<0.05), migration (P<0.05), angiogenesis (P<0.01), and the expression of ZO, occludin, claudin and JAM1 in tight junctions (P<0.01), gap junctions (Cx37 and Cx43; P<0.01) and adherens junctions (VE-cadherin, CTNNA1 and CTNNB1; P<0.05). However, when SPARC was downregulated by lentiviral vectors, the inhibitions induced by high concentrations of glucose were partially reversed. To conclude, the inhibitory effects on cell viability, migration, angiogenesis and cellular adhesion of HRCECs induced by high concentrations of glucose were reversed once the expression of SPARC was inhibited. These findings suggest that SPARC may serve an important role in pathogenesis of diabetic retinopathy.

This study was performed to assess the reliability and validity of the Chinese version of the Snizek-revised Hall's Professionalism Inventory Scale (C-SR-HPIS).

Cardiac activity has been widely used in marine molluscs as an indicator for their physiological status in response to environmental changes, which is, however, largely less studied in scallops. Here, we monitored cardiac performance of Zhikong scallop Chlamys farreri using an infrared-based method, and evaluated the effects of several biotic (shell height, total weight, and age) and environmental factors (circadian rhythm and temperature) on scallop heart rate (HR), amplitude (HA), and rate-amplitude product (RAP). Results revealed that size has a significant effect on both HR (negative) and HA (positive), but RAP values are similar in different sized scallops. Age also affects scallop cardiac performance, significantly for HR, but not for HA or RAP. Circadian rhythm affects cardiac activity, with significant elevation of HR, HA and RAP during 1:00-8:00 and 17:00-19:00. With seawater temperature elevation, HR peaks at 30.03 ± 0.23°C, HA at 15.08 ± 0.02°C, and RAP at 15.10 ± 0.19 and 30.12 ± 0.28°C. This suggests HR is a good indicator for thermal limit, whereas HA may indicate optimal growth temperature, and RAP could be an index of myocardial oxygen consumption to indicate myocardium stress. Our study provides basic information on the factors that may affect scallop cardiac performance. It also elucidates the feasibility of HA and RAP as cardiac indices in marine molluscs.

Recent progress in the induced generation of dopaminergic (DA) neurons from different types of stem cells or reprogrammed somatic cells holds tremendous potential for the treatment of Parkinson's disease (PD). However, the lack of a reliable source for cell replacement therapy remains a major limitation in the treatment of human neurological disorders. Additionally, the current protocols for in vitro differentiation or cell reprogramming to generate human DA neurons are laborious, time-consuming, and expensive, and efficient conversion of human spermatogonial stem cells (hSSCs) to functional DA neurons has not yet been achieved.

Extracellular vesicles (EVs) are involved in the regulation of cell physiological activity and the reconstruction of extracellular environment. Matrix vesicles (MVs) are a type of EVs released by bone-related functional cells, and they participate in the regulation of cell mineralization. Here, we report bioinspired MVs embedded with black phosphorus (BP) and functionalized with cell-specific aptamer (denoted as Apt-bioinspired MVs) for stimulating biomineralization. The aptamer can direct bioinspired MVs to targeted cells, and the increasing concentration of inorganic phosphate originating from BP can facilitate cell biomineralization. The photothermal effect of the Apt-bioinspired MVs can also promote the biomineralization process by stimulating the upregulated expression of heat shock proteins and alkaline phosphatase. In addition, the Apt-bioinspired MVs display outstanding bone regeneration performance. Our strategy provides a method for designing bionic tools to study the mechanisms of biological processes and advance the development of medical engineering.

Small nucleolar RNA host gene 1 (SNHG1) is critical in the progression of cancers. However, the mechanism by which SNHG1 regulates the progression of colorectal cancer (CRC) remains unclear. Expressions of SNHG1 and miR-137 in CRC tissues and cell lines were evaluated by quantitative real-time polymerase chain reaction. A luciferase reporter gene assay was conducted to investigate miR-137 target. Additionally, RNA pull-down assay was performed to explore the physical association between miR-137, SNHG1, and RNA induced silencing complex (RISC). Cell cycling and invasion were examined by flow cytometry (FCM) and transwell assays. The in vivo carcinogenic activity of SNHG1 was examined using murine xenograft models. Expression of RICTOR, serine/threonine kinase 1 (AKT), serum and glucocorticoid-inducible kinase 1 (SGK1), p70S6K1, and LC3II/LC3I ratio was examined by Western blot analysis. SNHG1 upregulation was observed in CRC tissues and cell lines, which was associated with the lymph node metastasis, advanced TNM stage and poorer prognosis. SNHG1 increased RICTOR level in CRC via sponging miR-137. In addition, SNHG1 silencing inhibited CRC cell proliferation and migration in vitro and in vivo. SNHG1 regulated RICTOR expression by sponging miR-137 and promoted tumorgenesis in CRC.

SIRT6, NAD+-dependent deacetylase sirtuin 6, has recently shown to suppress tumor growth in several types of cancer. Colon cancer is a challenging carcinoma associated with high morbidity and death. However, whether SIRT6 play a direct role in colon tumorigenesis and the underlying mechanism are not understood. Methods: To investigate the role of SIRT6 in colon cancer, we firstly analyzed the specimens from 50 colorectal cancer (CRC) patients. We generated shSIRT6 LoVo cells and xenograft mouse to reveal the essential role of SIRT6 in cell apoptosis and tumor growth. To explore the underlying mechanism of SIRT6 regulation, we performed FRET and real-time fluorescence imaging in living cells, real-time PCR, immunoprecipitaion, immunohistochemistry, flow cytometry and luciferase reporter assay. Results: The expression level of SIRT6 in patients' specimens is lower than that of normal controls, and patients with higher SIRT6 level have a better prognosis. Here, we identified that transcriptional factor FoxO3a is a direct up-stream of SIRT6 and positively regulated SIRT6 expression, which in turn, promotes apoptosis by activating Bax and mitochondrial pathway. Functional studies reveal that Akt inactivation increases FoxO3a activity and augment its binding to SIRT6 promoter, leading to elevated SIRT6 expression. Knocking down SIRT6 abolished apoptotic responses and conferred resistance to the treatment of BKM120. Combinational therapies with conventional drugs showed synergistic chemosensitization, which was SIRT6-dependent both in vitro and in vivo. Conclusion: The results uncover SIRT6 as a new potential biomarker for colon cancer, and its unappreciated mechanism about transcription and expression via Akt/FoxO3a pathway.

We created a novel inducible mouse line Keratocan-rtTA (KeraRT) that allows specific genetic modification in corneal keratocytes and tenocytes during development and in adults.

MicroRNAs (miRNAs) are important regulators involved in the antiviral response to influenza virus infection, however, an analytical comparison of miRNA and mRNA expression changes induced by several H7N9 host-adapting PB2 mutants remains undone. Here, miRNA microarray and transcriptome sequencing of BALB/c mouse lungs infected with A/Anhui/1/2013 (H7N9) [hereafter referred to as H7N9/AH1-PB2-627K(WT)] and mutant variants with PB2 amino acid substitutions (avian-like H7N9/AH1-PB2-627E and mammalian-adapted H7N9/AH1-PB2-627E/701N) were directly compared. The results showed that influenza virus infection induced dysregulation of numerous host cell processes. In a miRNA-mRNA network associated with immunity, changes in the expression of 38 miRNAs and 58 mRNAs were detected following influenza virus infection. Notably, the miRNAs of mmu-miR-188-5p, mmu-miR-511-5p, mmu-miR-483-5p, and mmu-miR-690 were specifically associated with the replication of the avian-like virus H7N9/AH1-PB2-627E. Likewise, the miRNAs of mmu-miR-691, mmu-miR-329-3p, and mmu-miR-144-3p were specifically associated with the mammalian-adapted virus H7N9/AH1-PB2-627E/701N. Finally, the miRNAs of mmu-miR-98-5p, mmu-miR-103-3p, mmu-miR-199a-5p, and mmu-miR-378a-3p were specifically associated with H7N9/AH1-PB2-627K(WT) virus replication. This is the first report of comparative integration analysis of miRNA-mRNA expression of these three H7N9 influenza viruses with different host-adapting PB2 mutations. Our results highlight potential miRNAs of importance in influenza virus pathogenesis.

Illness-related costs experienced by tuberculosis patients produce a severe economic impact on households, especially poor families. Few studies have investigated the full costs, including direct and indirect costs, at the patient and household levels in south-east China.

The application of fire-retardant fabrics is essential for providing thermal protective function of the garments. Appropriate clothing design are beneficial for preventing the wearers from skin burn injuries and heat strains simultaneously. The intention of this work was to investigate the effects of clothing ventilation designs on its thermal protective performance by bench-scale tests. Four boundary conditions were designed to simulate the garment aperture structures on fabric level. Tests of thermal shrinkage, mass loss and time-to-second-degree-burns were performed with and without air gap under three heat-flux levels for two kinds of inherently fire-retardant fabrics. The impacts of fabric type, heat-flux level, air gap and boundary condition were analyzed. The presence of a 6.4-mm air gap could improve thermal protective performance of the fabrics, however, the garment openings would decrease this positive effects. More severe thermal aging found for spaced test configuration indicated the importance of balancing the service life and thermal protective performance of the clothing. The findings of this study implied that the characteristics of fabric type, air gap, boundary condition, and their effects on fabric thermal aging should be considered during clothing ventilation designs, to balance the thermal protection and comfort of the protective gear.

The aim of the work was to investigate the effects of acacetin on endothelial dysfunction and aortic fibrosis in insulin-resistant SHR rats and explore its mechanism. Seven-week-old male spontaneously hypertensive rats (SHR) were selected to establish a rat model of hypertension with insulin resistance induced by 10% fructose. The nuclear factor kappa B p65 (NF-κB p65) and Collagen I were observed by Immunohistochemistry. Immunofluorescence was used to observe estrogen receptor-alpha (ERα), estrogen receptor-beta (ERβ), and G protein-coupled receptor 30 (GPR30). Western blotting was used to detect interleukin (IL-1β), Arginase 2 (ARG2), Nostrin, endothelial nitric oxide synthase (eNOS), TGF-β, Smad3, ERK pathway proteins such as p-c-Raf, p-MEK1/2, p-ERK, ERK, p-P90RSK and p-MSK1. We found that acacetin did have an improvement on endothelial dysfunction and fibrosis. Meanwhile, it was also found to have a significant effect on the level of estrogen in this model by accident. Then, the experiment of uterine weight gain in mice confirmed that acacetin had a certain estrogen-like effect in vivo and played its role through the estrogen receptors pathway. In vitro experience HUVEC cells were stimulated with 30 mM/L glucose and 100 mM/L NaCl for 24 h to establish the endothelial cell injury model. HUVEC cells were treated with 1 μM/L estrogen receptors antagonist (ICI 182780) for 30 min before administration. Cell experiments showed that acacetin could reduce the apoptosis of HUVEC cells, the levels of inflammatory cytokines and the expression of TGF-β, Collagen I and Smad3 in endothelial cell injury model. After treatment with ICI 182780, the improvement of acacetin was significantly reversed. The results showed that acacetin relieved endothelial dysfunction and reduced the aortic fibrosis in insulin-resistant SHR rats by reducing the release of inflammatory factors and improving vasodilatory function through estrogen signaling pathway.

Psoralea corylifolia L. (PC) is a traditional Chinese herb used to treat yang deficiency of the spleen and kidney in pediatric disease. Recent studies have shown its liver protection and anti-oxidative effects. The aim of this study was to explore the effect and mechanism of PC on nonalcoholic steatohepatitis in juvenile mice. The juvenile mouse model of nonalcoholic fatty liver disease/nonalcoholic steatohepatitis (NAFLD/NASH) was established by being fed a high-fat diet in maternal-offspring manner. PC granules were prepared and the quality was assessed. The main components were identified by high performance liquid chromatography. Then, different dosages of PC were administered for 6 weeks. Homeostatic model assessment of insulin resistance, plasma liver enzymes, hepatic morphology, hepatic superoxide anion, and triglyceride/total cholesterol levels were examined. The changes of nuclear factor-κB (NF-κB) activity phosphatidylinositol 3 kinase (PI3K)/protein kinase B (Akt) and protein kinase C-α (PKC-α)/nicotinamide-adenine dinucleotide phosphate (NADPH) oxidase signaling pathways in hepatic tissues were also determined. Our data demonstrated that PC significantly improved liver dysfunction, liver triglyceride/total cholesterol accumulation and insulin resistance in juvenile NAFLD/NASH mice. PC also alleviated hepatic steatosis, inflammatory cell infiltration, and fibroplasia in the portal area. Additionally, PC inhibited the activation of NF-κB and the mRNA expression of inflammatory factors while enhancing PI3K/Akt signaling in hepatic tissues. PC could also reduce hepatic superoxide anion levels, and NADPH oxidase activity as well as p47phox protein expression and PKCα activation in hepatic tissues. The results suggest that PC is effective in the treatment of NASH in juvenile mice. The mechanism may be related to the attenuation of hepatic oxidative stress through the PKC-α/NADPH oxidase signaling pathway.

Aneuploidy including trisomy results in developmental disabilities and is the leading cause of miscarriages in humans. Unlike trisomy 21, pathogenic mechanisms of trisomy 18 remain unclear. Here, we successfully generated induced pluripotent stem cells (iPSCs) from human amniotic fluid cells (AFCs) with trisomy 18 pregnancies. We found that trisomy 18 iPSCs (18T-iPSCs) were prone to differentiate spontaneously. Intriguingly, 18T-iPSCs lost their extra 18 chromosomes and converted to diploid cells after 10 generations. fluorescence in situ hybridization analysis showed chromosome loss was a random event that might happen in any trisomic cells. Selection undifferentiated cells for passage accelerated the recovery of euploid cells. Overall, our findings indicate the genomic instability of trisomy 18 iPSCs bearing an extra chromosome 18.