X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Search again

Showing 28 results out of 5,028,127 results on Page 1

Cite this Abcam Cat# ab17505 Lot# RRID:AB_443912
Vendor Catalog #: ab17505
AB Registry ID : AB_443912
Host Organism: mouse
Clonality: monoclonal antibody
Target(s): FGF basic antibody human, human

  • Antibody

Cite this (Texas State University; Texas; USA, RRID:SCR_013219)
Description:

  • Resource

Cite this FlyBase Cat# FBst0201269, RRID:FlyBase_FBst0201269
Source Database: FlyBase, catalog # FBst0201269
Genetic Background:
Affected Genes:
Variant Alleles: wild-type

  • Animal

Cite this Coriell Cat# GM11062, RRID:CVCL_4I48
Organism: Homo sapiens
Disease:
Category: Transformed cell line DT Created: 22-09-15; Last updated: 05-07-19; Version: 7
Comment: Population: Amish Caucasian. Transformant: NCBI_TaxID; 10376; Epstein-Barr virus (EBV). DT Created: 22-09-15; Last updated: 05-07-19; Version: 7

  • Cell lines

Cite this Julida, NCBITaxon:41448
Taxonomic Rank: order
Division Name: Invertebrates
Synonyms:

  • Taxonomy

Cite this IIDP, Cat# Pancreas-SCICRC-4223_Acinar, RRID:SAMN12598775
Organism: Homo sapiens
Disease: Diabetes
Category: Tissue: Pancreas
Comment: Human pancreatic islets were isolated using standardized procedures established at each manufacturing laboratory. Preparations were then distributed through the IIDP for use in scientific studies.; Provider: Fouad Kandeel,Southern California Islet Cell Resource Center, Duarte, CA, 91010; Age: 59.00 Years; Submission Date: 2019-08-19T00:00:09.740; Status of tissue: live

  • BioSamples

Cite this RRID:Addgene_70001
Plasmid Name: pRR-S5
Insert Name: CYP2B6
Organism: Homo sapiens
Comment:

  • AddGene

Cite this GenWay Biotech Inc. Cat# 18-461-10777-0.05 ml Lot# RRID:AB_1010851
Vendor Catalog #: 18-461-10777-0.05 ml
AB Registry ID : AB_1010851
Host Organism: rabbit
Clonality: polyclonal antibody
Target(s): Human FZD3 human

  • Antibody

Cite this (LI-COR Biosciences, RRID:SCR_013430)
Description: An Antibody supplier

  • Resource

Cite this BDSC Cat# 78427, RRID:BDSC_78427
Source Database: BDSC, catalog # 78427
Genetic Background:
Affected Genes: D,Hsap\FGFR4,UAS,Sb,Ser,w,y
Variant Alleles: Chromosome:1;2

  • Animal

Cite this Coriell Cat# GM11063, RRID:CVCL_4I49
Organism: Homo sapiens
Disease:
Category: Transformed cell line DT Created: 22-09-15; Last updated: 05-07-19; Version: 7
Comment: Population: Amish Caucasian. Transformant: NCBI_TaxID; 10376; Epstein-Barr virus (EBV). DT Created: 22-09-15; Last updated: 05-07-19; Version: 7

  • Cell lines

Cite this Cychrus, NCBITaxon:42030
Taxonomic Rank: genus
Division Name: Invertebrates
Synonyms:

  • Taxonomy

Cite this IIDP, Cat# Pancreas-Scharp/Lacy-4222_Islets, RRID:SAMN12598151
Organism: Homo sapiens
Disease: Diabetes
Category: Tissue: Pancreas
Comment: Human pancreatic islets were isolated using standardized procedures established at each manufacturing laboratory. Preparations were then distributed through the IIDP for use in scientific studies.; Provider: David Scharp,The Scharp-Lacy Research Institute, Aliso Viejo, CA, 92656; Age: 51.00 Years; Submission Date: 2019-08-18T20:31:04.121; Status of tissue: live

  • BioSamples

Cite this RRID:Addgene_29662
Plasmid Name: pET Flag TEV LIC cloning vector (1L)
Insert Name:
Organism:
Comment: This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV-cleavable FLAG fusion tag on its N-terminus. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3'Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

  • AddGene

Cite this Abcam Cat# ab15344 Lot# RRID:AB_443182
Vendor Catalog #: ab15344
AB Registry ID : AB_443182
Host Organism: rabbit
Clonality: polyclonal antibody
Target(s): FANCI antibody human

  • Antibody

Cite this (IsoLasso, RRID:SCR_013176)
Description: An algorithm to assemble transcripts and estimate their expression levels from RNA-Seq reads.

  • Resource

Cite this MMRRC Cat# 020884-UCD, RRID:MMRRC_020884-UCD
Source Database: MMRRC, catalog # 020884-UCD
Genetic Background: Gene Trap
Affected Genes:
Variant Alleles:

  • Animal

Cite this Coriell Cat# GM11064, RRID:CVCL_4I50
Organism: Homo sapiens
Disease:
Category: Transformed cell line DT Created: 22-09-15; Last updated: 05-07-19; Version: 7
Comment: Population: Amish Caucasian. Transformant: NCBI_TaxID; 10376; Epstein-Barr virus (EBV). DT Created: 22-09-15; Last updated: 05-07-19; Version: 7

  • Cell lines

Cite this Siamophryne, NCBITaxon:2107258
Taxonomic Rank: genus
Division Name: Vertebrates
Synonyms:

  • Taxonomy

Cite this IIDP, Cat# Pancreas-SCICRC-4221_Islets, RRID:SAMN12597653
Organism: Homo sapiens
Disease: Diabetes
Category: Tissue: Pancreas
Comment: Human pancreatic islets were isolated using standardized procedures established at each manufacturing laboratory. Preparations were then distributed through the IIDP for use in scientific studies.; Provider: Fouad Kandeel,Southern California Islet Cell Resource Center, Duarte, CA, 91010; Age: 42.00 Years; Submission Date: 2019-08-18T14:55:03.891; Status of tissue: live

  • BioSamples

Cite this RRID:Addgene_49346
Plasmid Name: pGLB2 5'3'
Insert Name: Bmp2 distal promoter
Organism: Mus musculus
Comment: 5' region contains nt –1,237 to 471 relative to distal transcription start.3' region contains nt 9574-11604 relative to distal transcription start and contains two Bmp2 polyadenylation signals yielding 3’UTRs of 870 and 1185 nt (Liu et al. PMID 18703506) and downstream flanking sequence.

  • AddGene

Cite this Abcam Cat# ab16567 Lot# RRID:AB_443405
Vendor Catalog #: ab16567
AB Registry ID : AB_443405
Host Organism: mouse
Clonality: monoclonal antibody
Target(s): Lambda Light chain antibody [ICO106] human

  • Antibody

Cite this (MethLAB, RRID:SCR_010957)
Description: A GUI software package for analysis of DNA methylation microarray data.

  • Resource

Cite this FlyBase Cat# FBst0464469, RRID:FlyBase_FBst0464469
Source Database: FlyBase, catalog # FBst0464469
Genetic Background:
Affected Genes:
Variant Alleles:

  • Animal

Cite this Coriell Cat# GM11065, RRID:CVCL_4I51
Organism: Homo sapiens
Disease: Manic bipolar affective disorder
Category: Transformed cell line DT Created: 22-09-15; Last updated: 05-07-19; Version: 7
Comment: Population: Amish Caucasian. Transformant: NCBI_TaxID; 10376; Epstein-Barr virus (EBV). DT Created: 22-09-15; Last updated: 05-07-19; Version: 7

  • Cell lines

Cite this Anathana, NCBITaxon:320339
Taxonomic Rank: genus
Division Name: Mammals
Synonyms:

  • Taxonomy

Cite this IIDP, Cat# Pancreas-U.Penn-4220_Acinar, RRID:SAMN12572087
Organism: Homo sapiens
Disease: Diabetes
Category: Tissue: Pancreas
Comment: Human pancreatic islets were isolated using standardized procedures established at each manufacturing laboratory. Preparations were then distributed through the IIDP for use in scientific studies.; Provider: Ali Naji,University of Pennsylvania, Philadelphia, PA, 19104; Age: 21.00 Years; Submission Date: 2019-08-14T11:40:04.094; Status of tissue: live

  • BioSamples

Cite this RRID:Addgene_19736
Plasmid Name: pRSETA-betaFlincG
Insert Name: beta-FlincG
Organism: Bovine
Comment:

  • AddGene