X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Search again

Showing 28 results out of 4,997,022 results on Page 1

Cite this Bio-Rad Cat# MCA2479 Lot# RRID:AB_609604
Vendor Catalog #: MCA2479
AB Registry ID : AB_609604
Host Organism: mouse
Clonality: monoclonal antibody
Target(s): MOUSE ANTI DUCK CD8 ALPHA chicken/bird, duck

  • Antibody

Cite this (National High Magnetic Field Lab DC Field Core Facility, RRID:SCR_017358)
Description: Facility located at MagLab headquarters near Florida State University in Tallahassee. Contains 14 resistive magnet cells connected to 56 megawatt DC power supply and 15,000 square feet of cooling equipment to remove heat generated by magnets. Includes several superconducting magnets operating at millikelvin temperatures. Among these instruments is 45-tesla hybrid magnet, which offers scientists strongest continuous magnetic field in world. Research is supported by magnet plant and cryogenic system operators. Technicians design, build and repair instruments for user research.

  • Resource

Cite this MGI Cat# 5630261, RRID:MGI:5630261
Source Database: MGI, catalog # 5630261
Genetic Background:
Affected Genes: Rrad
Variant Alleles:

  • Animal

Cite this ECACC Cat# 96082302, RRID:CVCL_8W19
Organism: Homo sapiens
Disease:
Category: Transformed cell line DT Created: 23-02-16; Last updated: 07-09-18; Version: 4
Comment: Part of: ECACC chromosomal abnormality collection. Transformant: NCBI_TaxID; 10376; Epstein-Barr virus (EBV). DT Created: 23-02-16; Last updated: 07-09-18; Version: 4

  • Cell lines

Cite this Julida, NCBITaxon:41448
Taxonomic Rank: order
Division Name: Invertebrates
Synonyms:

  • Taxonomy

Cite this IIDP, Cat# 1991, RRID:SAMN08634085
Organism: Homo sapiens
Disease: Diabetes
Category: Tissue: Pancreas
Comment: Human pancreatic islets were isolated using standardized procedures established at each manufacturing laboratory. Preparations were then distributed through the IIDP for use in scientific studies.; Provider: Luis Fernandez,University of Wisconsin, Madison, WI, 53705-2275; Age: Missing; Submission Date: 2018-03-04T09:16:03.723; Status of tissue: live

  • BioSamples

Cite this RRID:Addgene_87759
Plasmid Name: pCZGY2838
Insert Name: Pmyo-3-PH-miniSOG
Organism: Caenorhabditis elegans
Comment:

  • AddGene

Cite this Bio-Rad Cat# OBT0728 Lot# RRID:AB_609606
Vendor Catalog #: OBT0728
AB Registry ID : AB_609606
Host Organism: mouse
Clonality: monoclonal antibody
Target(s): MOUSE ANTI CLOSTRIDIUM BOTULINUM TOXOID D bacteria/archaea, bacterial

  • Antibody

Cite this (LDMatrix, RRID:SCR_017391)
Description: Software tool to create interactive heatmap matrix of pairwise linkage disequilibrium statistics.

  • Resource

Cite this MGI Cat# 5493449, RRID:MGI:5493449
Source Database: MGI, catalog # 5493449
Genetic Background: involves: 129P2/OlaHsd * C57BL/6
Affected Genes: Nkx2-5
Variant Alleles: tm1Wehi

  • Animal

Cite this ECACC Cat# 96091307, RRID:CVCL_8W20
Organism: Homo sapiens
Disease:
Category: Transformed cell line DT Created: 23-02-16; Last updated: 07-09-18; Version: 4
Comment: Part of: ECACC chromosomal abnormality collection. Transformant: NCBI_TaxID; 10376; Epstein-Barr virus (EBV). DT Created: 23-02-16; Last updated: 07-09-18; Version: 4

  • Cell lines

Cite this Cychrus, NCBITaxon:42030
Taxonomic Rank: genus
Division Name: Invertebrates
Synonyms:

  • Taxonomy

Cite this IIDP, Cat# 1973, RRID:SAMN08612556
Organism: Homo sapiens
Disease: Diabetes
Category: Tissue: Pancreas
Comment: IIDP Submission for Human Islets; Provider: Luis Fernandez,University of Wisconsin, Madison, WI, 53705-2275; Age: 53.00 Years; Submission Date: 2018-02-27T00:55:04.663; Status of tissue: live

  • BioSamples

Cite this RRID:Addgene_128283
Plasmid Name: pCC2
Insert Name: Piq - mRFP, _parS
Organism: Synthetic
Comment: Cloning method: Golden Gate.

  • AddGene

Cite this Bio-Rad Cat# 131008 Lot# RRID:AB_609608
Vendor Catalog #: 131008
AB Registry ID : AB_609608
Host Organism: goat
Clonality: polyclonal antibody
Target(s): GOAT ANTI HUMAN COLLAGEN I: human

  • Antibody

Cite this (Image analysis of V1 ocular dominance patterns, RRID:SCR_017381)
Description: Software tool to quantify ocular dominance patterns of primary visual cortex in different animals.

  • Resource

Cite this MGI Cat# 4360280, RRID:MGI:4360280
Source Database: MGI, catalog # 4360280
Genetic Background:
Affected Genes: "Tg(TXNRD2,COMT,ARVCF)1Nhir"
Variant Alleles:

  • Animal

Cite this ECACC Cat# 89061426, RRID:CVCL_8X31
Organism: Homo sapiens
Disease:
Category: Finite cell line DT Created: 23-02-16; Last updated: 07-09-18; Version: 2
Comment: Part of: ECACC chromosomal abnormality collection. DT Created: 23-02-16; Last updated: 07-09-18; Version: 2

  • Cell lines

Cite this Siamophryne, NCBITaxon:2107258
Taxonomic Rank: genus
Division Name: Vertebrates
Synonyms:

  • Taxonomy

Cite this IIDP, Cat# 851, RRID:SAMN08498329
Organism: Homo sapiens
Disease: Diabetes
Category: Tissue: Pancreas
Comment: IIDP Submission for Human Islets; Provider: Camilo Ricordi,University of Miami, Miami, FL, 33136; Age: 51.00 Years; Submission Date: 2018-02-08T08:56:21.646; Status of tissue: live

  • BioSamples

Cite this RRID:Addgene_103587
Plasmid Name: LSB-hsa-miR-508-3p
Insert Name: hsa-miR-508-3p target
Organism: Homo sapiens
Comment: The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC

  • AddGene

Cite this Bio-Rad Cat# AHP1031 Lot# RRID:AB_2083737
Vendor Catalog #: AHP1031
AB Registry ID : AB_2083737
Host Organism: rabbit
Clonality: polyclonal antibody
Target(s): RABBIT ANTI HUMAN G-CSF human

  • Antibody

Cite this (fastMNN, RRID:SCR_017351)
Description: Software tool to correct for batch effects in single-cell expression data using fast version of mutual nearest neighbors (MNN) method.

  • Resource

Cite this ZIRC Cat# ZL12727.02, RRID:ZIRC_ZL12727.02
Source Database: ZIRC, catalog # ZL12727.02
Genetic Background: disclaimer
Affected Genes: ftr23
Variant Alleles: sa33022

  • Animal

Cite this ECACC Cat# 97102213, RRID:CVCL_8W21
Organism: Homo sapiens
Disease: Triple A syndrome
Category: Transformed cell line DT Created: 23-02-16; Last updated: 07-09-18; Version: 4
Comment: Part of: ECACC chromosomal abnormality collection. Transformant: NCBI_TaxID; 10376; Epstein-Barr virus (EBV). DT Created: 23-02-16; Last updated: 07-09-18; Version: 4

  • Cell lines

Cite this Anathana, NCBITaxon:320339
Taxonomic Rank: genus
Division Name: Mammals
Synonyms:

  • Taxonomy

Cite this IIDP, Cat# 1970, RRID:SAMN08612554
Organism: Homo sapiens
Disease: Diabetes
Category: Tissue: Pancreas
Comment: IIDP Submission for Human Islets; Provider: Camilo Ricordi,University of Miami, Miami, FL, 33136; Age: 51.00 Years; Submission Date: 2018-02-27T00:00:09.733; Status of tissue: live

  • BioSamples

Cite this RRID:Addgene_50787
Plasmid Name: pMXs-ms-Klf5
Insert Name: Klf5
Organism: Mus musculus
Comment:

  • AddGene