Glucose affects cell viability, migration, angiogenesis and cellular adhesion of human retinal capillary endothelial cells via SPARC.

The expression of secreted protein acidic and rich in cysteine (SPARC) has been recently identified to be associated with the pathology of diabetic retinopathy. Therefore, the present study aimed to evaluate the regulatory role of SPARC in human retinal capillary endothelial cells (HRCECs), following exposure to a high glucose environment in vitro. The cell viability, migration, angiogenesis, permeability and SPARC expression levels of HRCECs were measured following treatment with different concentrations of glucose (25, 50 or 100 mM). Lentiviral vectors (LV185-pL_shRNA_mKate2-SPARC-543; target sequence, GGATGAGGACAACAACCTTCT) that inhibit the expression of SPARC were constructed, and HRCECs were evaluated when infected by viruses carrying the lentiviral vectors. Cell viability was examined using the Cell Counting Kit-8 assay. The expression of SPARC in HRCECs increased as the concentration of glucose in the culture medium increased. Relatively high concentrations of glucose significantly inhibited cell proliferation (P<0.05), migration (P<0.05), angiogenesis (P<0.01), and the expression of ZO, occludin, claudin and JAM1 in tight junctions (P<0.01), gap junctions (Cx37 and Cx43; P<0.01) and adherens junctions (VE-cadherin, CTNNA1 and CTNNB1; P<0.05). However, when SPARC was downregulated by lentiviral vectors, the inhibitions induced by high concentrations of glucose were partially reversed. To conclude, the inhibitory effects on cell viability, migration, angiogenesis and cellular adhesion of HRCECs induced by high concentrations of glucose were reversed once the expression of SPARC was inhibited. These findings suggest that SPARC may serve an important role in pathogenesis of diabetic retinopathy.

Pubmed ID: 30651792 RIS Download