Searching the Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

This service exclusively searches for literature that cites resources. Please be aware that the total number of searchable documents is limited to those containing RRIDs and does not include all open-access literature.

Search

Type in a keyword to search

On page 347 showing 6921 ~ 6940 papers out of 2,794,544 papers

HIF-α/PKM2 and PI3K-AKT pathways involved in the protection by dexmedetomidine against isoflurane or bupivacaine-induced apoptosis in hippocampal neuronal HT22 cells.

  • Fangping Bao‎ et al.
  • Experimental and therapeutic medicine‎
  • 2019‎

The present study investigated the mechanism underlying the protective effect of dexmedetomidine (Dex) on hippocampal neuronal HT22 cell apoptosis induced by the anesthetics isoflurane and bupivacaine. The cellular morphology was observed using a phase contrast microscope. The effects of anesthetics on cell proliferation were assayed using a Cell Counting Kit-8 (CCK-8). The levels of apoptosis were examined by flow cytometry utilizing Annexin V-fluorescein isothiocyanate/propidium iodide double staining, and the protein expression levels of cleaved caspase-3, phosphorylated phosphoinositide 3'-kinase (p-PI3K), p-protein kinase B (p-AKT), hypoxia inducible factor (HIF-α), pyruvate kinase M2 (PKM2), B-cell lymphoma (Bcl-2)-associated X protein (Bax), Bcl-2 and cytochrome c were detected by western blot analysis. In vitro treatment with anesthetics was identified to decrease cell proliferation (P<0.01), the effect of which was then markedly inhibited by treatment with Dex (P<0.01) or a PI3K/AKT agonist. Exposure to anesthetics induced apoptosis in HT22 cells (75.4%), which was significantly attenuated by co-treatment with Dex (26.2%) or the PI3K/AKT agonist (28.1%). Analysis of the protein expression levels revealed that exposure to anesthetics resulted in the activation of cleaved caspase-3, Bax, cytochrome c, HIF-α and PKM2 and decreased the expression levels of Bcl-2, p-PI3K and p-AKT. However, these changes were inhibited by treatment with Dex or the PI3K/AKT agonist. Dex protected hippocampal neuronal HT22 cells from anesthetic-induced apoptosis through the promotion of the PI3K/AKT pathway and inhibition of the HIF-α/PKM2 axis.


The combination of NVP-BEZ235 and rapamycin regulates nasopharyngeal carcinoma cell viability and apoptosis via the PI3K/AKT/mTOR pathway.

  • Hui Luo‎ et al.
  • Experimental and therapeutic medicine‎
  • 2019‎

Nasopharyngeal carcinoma (NPC) is a rare malignancy with a remarkable geographical distribution. Regarding NPC treatment, improving the survival rate of advanced patients seems promising. Phosphoinositide 3-kinase (PI3K)/protein kinase B (AKT)/mammalian target of rapamycin (mTOR) pathway deregulation is closely associated with tumorigenesis. In the present study, the NPC cell line SUNE1 was divided into four groups: Control, NVP-BEZ235, rapamycin, and NVP-BEZ235+rapamycin. SUNE1 cells in the NVP-BEZ235 group were incubated with NVP-BEZ235; cells in the rapamycin group were incubated with rapamycin, whereas the NVP-BEZ235+rapamycin group refers to SUNE1 cells incubated with a mixture of NVP-BEZ235 and rapamycin. The control group was treated with the same amount of vehicle. Morphological, MTT, terminal deoxynucleotidyl-transferase-mediated dUTP nick end labeling and flow cytometry assays demonstrated that NVP-BEZ235 and rapamycin caused morphological changes, inhibited cell viability and induced cellular apoptosis. In addition, reverse transcription-quantitative polymerase chain reaction and western blot revealed that the combination of NVP-BEZ235 and rapamycin affected the activation of the PI3K/AKT/mTOR pathway. The combination of NVP-BEZ235 and rapamycin significantly improved the effect of the drug therapy. The potential underlying mechanism may comprise the joint effects of inhibiting cell viability, promoting cellular apoptosis and reducing relative signal protein expression levels in SUNE1 cells. These findings provided novel evidence that NVP-BEZ235 suppresses NPC development, and indicated a promising potential application of combination drug therapy (NVP-BEZ235+rapamycin) for the clinical treatment of NPC.


Biological effects different diameters of Tussah silk fibroin nanofibers on olfactory ensheathing cells.

  • Peng Wu‎ et al.
  • Experimental and therapeutic medicine‎
  • 2019‎

Transplantation of olfactory ensheathing cells (OECs) has potential for treating spinal cord and brain injury. However, they are void of an extracellular matrix to support cell growth and migration. Engineering of tissue to mimic the extracellular matrix is a potential solution for neural repair. Tussah silk fibroin (TSF) has good biocompatibility and an Arg-Gly-Asp tripeptide sequence. A small number of studies have assessed the effect of the diameter of TSF nanofibers on cell adhesion, growth and migration. In the present study, TSF nanofibers with a diameter of 400 and 1,200 nm were prepared using electrospinning technology; these were then used as scaffolds for OECs. The structure and morphology of the TSF nanofibers were characterized by scanning electron microscopy (SEM) and Fourier-transform infrared spectroscopy. An inverted-phase contrast microscope and SEM were used to observe the morphology of OECs on the TSF nanofibers. The effect on the adhesion of the cells was observed following crystal violet staining. The phenotype of the cells and the maximum axon length on the scaffolds were evaluated by immunostaining for nerve growth factor receptor p75. Cell proliferation and viability were assessed by an MTT assay and a Live/Dead reagent kit. The migration efficiency of OECs was observed using live-cell microscopy. The results indicated that a 400-nm TSF fiber scaffold was more conducive to OEC adhesion, growth and migration compared with a 1,200-nm TSF scaffold. The phenotype of the OECs was normal, and no difference in OEC phenotype was observe when comparing those on TSF nanofibers to those on PLL. The present study may provide guidance regarding the preparation of tissue-engineered materials for neural repair.


Complications of cataract surgery in Wistar rats undergoing treatment with tamsulosin.

  • Raluca Maria Popescu‎ et al.
  • Experimental and therapeutic medicine‎
  • 2019‎

The aim of the study was to identify if there is a connection between the time of administration of alpha-blocker medication and cataract surgery complications. Furthermore, it was explored whether discontinuation of tamsulosin before cataract surgery influences the manifestations of intraoperative floppy iris syndrome in rats. An experimental study was conducted on 20 male Wistar rats aged 1.5-2 years (body mean weight 357 g), which were divided into four equal groups: Group 1, under tamsulosin hydrochloride 0.4 mg/day for 2 months; group 2, without any treatment in the first month, followed by tamsulosin; group 3, under tamsulosin for 1 month, followed by 1 month without any treatment; and group 4, control. The pupillary diameter was assessed before instillation of 0.5% tropicamide (mydriatic and cycloplegic agent), after 1 or 2 h from instillation and postoperatively. Furthermore, pupil constriction during surgery, the presence of floppy iris and prolapse of the iris following the main incision and during serum injection were also assessed. Other analyzed features included iris rupture, posterior capsule tear, vitreous loss, lens fragments in the vitreous, suprachoroidal bleeding and corneal haze. The iris dilator muscle thickness and the posterior epithelium was measured using light microscopy. In the control group, the largest pupillary diameters were indicated and in group 1, the smallest pupillary diameters were revealed. Statistically significant differences were indicated between group 1 and 2 and group 3 and 4. Floppy iris, iris prolapse in the main incision and during serum injection appeared at maximum frequency for group 1 with continuous treatment and low frequency for the control group. Lens fragments in the vitreous were present in the groups 1-3. Notably, intraoperative miosis had statistical relevance in group 1 and group 2. To conclude, the present findings suggested there is a clear connection between the time of administration of the alpha-blocker medication and most cataract complications. The results indicated that discontinuation of tamsulosin for one month largely reduces the manifestations of intraoperative floppy iris syndrome in rats, which may suggest to change preoperative treatment for benign prostatic hypertrophy with another class of drugs that do not interact with the iris receptors.


Soluble triggering receptor expressed on myeloid cells-1 as a useful biomarker for diagnosing ventilator-associated pneumonia after congenital cardiac surgery in children.

  • Chunxiang Li‎ et al.
  • Experimental and therapeutic medicine‎
  • 2019‎

The present study aimed to assess the usefulness of soluble triggering receptor expressed on myeloid cells 1 (sTREM-1) in the diagnosis of ventilator-associated pneumonia (VAP) in paediatric patients with congenital heart disease (CHD) following cardiac surgery. The current prospective study enrolled 48 patients with congenital heart diseases who were suspected of having VAP; these patients were undergoing cardiac surgery between August 2016 and October 2017 in the Cardiac Intensive Care Unit of Shanghai Children's Medical Center (Shanghai, China). A total of 31 patients were diagnosed with VAP using a polymerase chain reaction (PCR) assay, while 17 patients without VAP were designated as the Non-VAP group. A bronchoscopy was performed and samples were collected for measurement on the day that VAP was diagnosed. The sTREM-1 levels were measured in bronchoalveolar lavage fluid (BALF) and exhaled ventilator condensate (EVC). BALF specimens were also sent to the microbiology laboratory for PCR assays and quantitative culturing. The positive detection rate of bacteria using the PCR assay and traditional culture was 64.6% (31/48) and 39.6% (19/48). sTREM-1 was significantly higher in the BALF (146.21 pg/ml vs. 118.06 pg/ml) and EVC (125.29 pg/ml vs. 120.48 pg/ml) of patients with VAP demonstrated compared with the patients without VAP. The findings suggest that the detection of sTREM-1 in BALF and EVC samples may be useful for the diagnosis of VAP following heart surgery in children.


miRNA-101 promotes chondrogenic differentiation in rat bone marrow mesenchymal stem cells.

  • Feng Gao‎ et al.
  • Experimental and therapeutic medicine‎
  • 2019‎

Effect and related mechanisms of miR-101 on the chondrogenic differentiation of rat bone marrow mesenchymal stem cells (MSCs) were investigated. The expression level of miR-101 was detected during chondrogenic differentiation. Three groups were established to study the potential function between miR-101 and chondrogenic differentiation: miR-NC group (negative control), miR-101 mimics (BMSCs transfected by miR-101 mimics) and mimics + inhibitor (BMSCs transfected by miR-101 mimics and inhibitor), after the induction of chondrogenic differentiation, the cell viability of MSCs and chondrogenic markers were determined, further, the expression level of Sox9 and Runx2 were detected. In our present research, miR-101 was found upregulated during chondrogenic differentiation of MSCs. Compared with the miR-NC group, the cell viability of MSCs was enhanced and the expression level of chondrogenic markers were respectively gained. The expression level of Sox9 was increased but the expression level of Runx2 was decreased by treatment of miR-101 mimics after induction of chondrogenic differentiation. However, these variations of the indicators were reversed by the intervention using the miR-101 inhibitor. Collectively, our research revealed promotion function of miR-101 on chondrogenic differentiation of MSCs, indicating that miR-101 could be a potential therapeutic strategy for the treatment of osteoarthritis (OA).


Elevated methylation of cyclin dependent kinase inhibitor 2B contributes to the risk of coronary heart disease in women.

  • Xiaomin Chen‎ et al.
  • Experimental and therapeutic medicine‎
  • 2019‎

Cyclin dependent kinase inhibitor 2B (CDKN2B) encodes a cyclin-dependent kinase inhibitor that may enhance the formation of atherosclerotic plaques. The aim of the present study was to investigate the contribution of CDKN2B promoter methylation on the risk of coronary heart disease (CHD). The present results indicated a significant association between increased CDKN2B methylation and the risk of CHD (adjusted P=0.043). A breakdown analysis according to sex demonstrated that CDKN2B methylation was significantly associated with the risk of CHD in women (adjusted P=0.010), but not in men. A further breakdown analysis by age indicated a significant association of CHD in the women >60 years (P=0.024). Luciferase reporter gene assay results indicated that the CDKN2B promoter fragment significantly enhanced luciferase activity (P<0.001). In addition, CDKN2B transcription was significantly enhanced following treatment with 5-aza-2'-deoxycytidine methylation inhibitor in human aortic endothelial cells (HAEC) and human primary coronary artery smooth muscle cells (HPCASMC; P<0.05 and P<0.01), but not in 293 cells. Notably, estrogen treatment reduced CDKN2B methylation of several CpGs and significantly increased CDKN2B gene expression levels in HAEC, HPCASMC and 293 cells (P<0.05 and P<0.01). Additionally, treatment of HAEC and HPCASMC with simvastatin and γ-carboxy-L-glutamic acid reduced CDKN2B promoter methylation and increased CDKN2B transcription concomitantly. The present study suggests that CDKN2B promoter methylation may be associated with sex dimorphism in the pathogenesis of CHD.


Coexpression modules constructed by weighted gene co-expression network analysis indicate ubiquitin-mediated proteolysis as a potential biomarker of uveal melanoma.

  • Meng Yang‎ et al.
  • Experimental and therapeutic medicine‎
  • 2019‎

Uveal melanoma (UM) is a tumor that affects individuals throughout the world. Although gene expression analysis of UM has been performed previously, systemic co-expression analysis for this type of cancer remains lacking. Microarray data of UM samples was obtained from the Genome Expression Omnibus (dataset GSE44295). Co-expression modules were built by weighted gene co-expression network analysis. Functional enrichment analysis was performed on the co-expressed genes from important modules. Seven co-expression modules were constructed from the 5,000 genes gathered from the 58 human UM samples. The number of genes in these modules ranged from 73 to 3,051, with the mean number being 711. There was a marked difference in interactions among pairwise modules. Functional enrichment analysis demonstrated that module 2 was mainly enriched in pathways associated with the regulation of transcription. Additionally, modules 2-4 were significantly enriched in the ubiquitin mediated proteolysis pathway, suggesting it could serve a critical role in the occurrence and development of UM. The findings of the present study present a framework of co-expressed gene modules for human UM and provide an improved understanding of these modules at a functional level. Understanding the molecular mechanism and cellular pathways involved in pathogenesis of UM is extremely important for the development of more effective diagnostic and therapeutic strategies.


Glucose affects cell viability, migration, angiogenesis and cellular adhesion of human retinal capillary endothelial cells via SPARC.

  • Yang Fu‎ et al.
  • Experimental and therapeutic medicine‎
  • 2019‎

The expression of secreted protein acidic and rich in cysteine (SPARC) has been recently identified to be associated with the pathology of diabetic retinopathy. Therefore, the present study aimed to evaluate the regulatory role of SPARC in human retinal capillary endothelial cells (HRCECs), following exposure to a high glucose environment in vitro. The cell viability, migration, angiogenesis, permeability and SPARC expression levels of HRCECs were measured following treatment with different concentrations of glucose (25, 50 or 100 mM). Lentiviral vectors (LV185-pL_shRNA_mKate2-SPARC-543; target sequence, GGATGAGGACAACAACCTTCT) that inhibit the expression of SPARC were constructed, and HRCECs were evaluated when infected by viruses carrying the lentiviral vectors. Cell viability was examined using the Cell Counting Kit-8 assay. The expression of SPARC in HRCECs increased as the concentration of glucose in the culture medium increased. Relatively high concentrations of glucose significantly inhibited cell proliferation (P<0.05), migration (P<0.05), angiogenesis (P<0.01), and the expression of ZO, occludin, claudin and JAM1 in tight junctions (P<0.01), gap junctions (Cx37 and Cx43; P<0.01) and adherens junctions (VE-cadherin, CTNNA1 and CTNNB1; P<0.05). However, when SPARC was downregulated by lentiviral vectors, the inhibitions induced by high concentrations of glucose were partially reversed. To conclude, the inhibitory effects on cell viability, migration, angiogenesis and cellular adhesion of HRCECs induced by high concentrations of glucose were reversed once the expression of SPARC was inhibited. These findings suggest that SPARC may serve an important role in pathogenesis of diabetic retinopathy.


International normalized ratio on admission predicts the 90-day mortality of critically ill patients undergoing endarterectomy.

  • Lang-Ping Tan‎ et al.
  • Experimental and therapeutic medicine‎
  • 2019‎

The association of the international normalized ratio (INR) with the long-term clinical outcome of patients who undergo endarterectomy has not yet been studied. The present study therefore primarily aimed to evaluate the association of INR on admission with the 90-day mortality of critically ill patients who underwent endarterectomy during hospitalization. The Medical Information Mart for Intensive Care III database was queried for patients undergoing endarterectomy. The 90-day mortality of patients was selected as a primary endpoint. Receiver-operating characteristic (ROC) curves were plotted to present the accuracy of predictions. Kaplan-Meier curves and multivariate Cox regression analysis were performed to analyse associations. Propensity score matching (PSM) was also conducted to reduce confounding bias. A total of 230 patients were included, with 36 90-day non-survivors. Patients with a high INR (≥1.5) on admission exhibited a higher 90-day mortality than those with a low INR (<1.5; 29.09 vs. 11.43%; P=0.003). The ROC area under the curve value was 0.687 [95% confidence interval (CI), 0.571-0.780]. Kaplan-Meier plots identified divergence in survival between patients with different INR levels (log-rank test, P=0.0013). The results of the multivariate Cox regression analysis indicated that a high INR level was significantly associated with 90-day mortality (hazard ratio, 2.19; 95% CI, 1.08-4.45; P=0.0305). Analysis of the PSM cohort presented similar results. In conclusion, the INR levels of critically ill patients who undergo endarterectomy may be used to stratify their risk of 90-day mortality.


Gene mutation analysis and genetic counseling for patients with non-syndromic hearing loss in Linyi region.

  • Huafeng Li‎ et al.
  • Experimental and therapeutic medicine‎
  • 2019‎

Through gene mutation analysis of patients with non-syndromic hearing loss (NSHL) correct genetic counseling for patients with NSHL and their family members were provided. A total of 116 patients suffering from NSHL were selected, and Sanger sequencing was applied to analyze 31 mutation sites in four deafness genes [gap junction β-2 (GJB2), solute carrier family 26, member 4 (SLC26A4), GJB3 and mitochondria 12S ribosomal ribonucleic acid (12SrRNA)]. Based on detection results, for the families with reproductive needs, amniotic fluid was extracted from pregnant women during proper gestational weeks to identify fetal genotypes and predict hearing state. Among 116 patients with NSHL, 51 patients carrying definite pathogenic mutation were found, including 35 patients with GJB2 mutations, 14 patients with SLC26A4 gene mutations and 2 patients with mitochondrial deoxyribonucleic acid 12SrRNA (mtDNA 12SrRNA) mutations. No GJB3 gene mutation site was detected. In addition, prenatal diagnosis to 17 pregnant women who had given birth to babies with deafness was performed, and results suggested that genotypes of 6 fetuses were consistent with those of probands, genotypes of 8 fetuses were consistent with those of their parents, and no mutation was found in the other 3 fetuses. Gene mutation analysis of patients with NSHL can identify the etiology and provide appropriate genetic counseling and birth guiding for patients with NSHL and their family members. In addition, prenatal diagnosis to the families who plan to give birth again can avoid the natality of fetuses with hearing loss.


miR-96 promotes collagen deposition in keloids by targeting Smad7.

  • Li Chao‎ et al.
  • Experimental and therapeutic medicine‎
  • 2019‎

The abnormal upregulation of transforming growth factor-β (TGF-β) signaling has been demonstrated to initiate keloid formation and progression. Keloid is a type of benign skin tumor that may occur following sustaining skin injury. microRNA-96 (miR-96) serves an important role in the progression of various malignant diseases. Using reverse transcription quantitative polymerase chain reaction (RT-qPCR), the present study demonstrated that miR-96 was overexpressed in keloid-derived fibroblasts (KFs). Luciferase reporter assay revealed mothers against decapentaplegic homolog (Smad)7, which is one of the important inhibitory factors in the TGF-β pathway, as a direct target of miR-96. miR-96 was initially observed to be correlated with the deposition of type I collagen in KFs in vitro. The miR-96 antagomir, was directly added into the keloid organ culture (OC) to find its significant antifibrotic potential, such as keloid OC shrinkage, exhibited by its dry weight loss and improved dermis architecture, exhibited by Masson's staining. Following miR-96 antagomir treatment, a reduction in the mRNA and protein expression levels of collagen type I α 1 chain and collagen type 3 α 1 chain within keloid OC tissues was observed. The present study revealed that miR-96 serves an important role in pathogenic keloid formation, suggesting that miR-96 antagomir has the potential to prevent keloid progression.


Bifidobacterium lactis Ameliorates the Risk of Food Allergy in Chinese Children by Affecting Relative Percentage of Treg and Th17 Cells.

  • Qingbin Liu‎ et al.
  • The Canadian journal of infectious diseases & medical microbiology = Journal canadien des maladies infectieuses et de la microbiologie medicale‎
  • 2018‎

We aimed to explore the therapeutic effect of Bifidobacterium lactis on food allergy by investigating the percentage of Treg and Th17 cells in Chinese children and related molecular mechanisms. A total of 256 children with food allergy were evenly assigned into two groups: BG, the children received 10 ml B. lactis (1 × 106/ml) daily, and CG, the children received the solution without B. lactis daily for three months. Allergic symptoms, serum IgE, and food antigen-specific IgE were measured. A mouse allergy model was established by using shrimp tropomyosin and treated with B. lactis. Relative mRNA levels of Treg- and Th17-associated cytokines were measured by using quantitative PCR. The percentage of Treg and Th17 cells in spleen were measured by using flow cytometry. After 3-month therapy, the allergic symptoms of the BG were remarkably reduced when compared with the CG (P < 0.05). Serum levels of IgE and food antigen-specific IgE were decreased too (P < 0.05). Similar results were also found in a mouse allergy model. After B. lactis treatment, the relative mRNA level of FoxP3 was significantly enhanced in the B. lactis therapy group when compared to positive controls. In addition, relative mRNA levels of FoxP3 and TGF-β associated with Treg cells were increased, whereas relative mRNA levels of IL-17A and IL-23 associated with Th17 were reduced. B. lactis treatment significantly increased the ratio of Treg and Th17 cells in a mouse allergy model (P < 0.05). B. lactis effectively alleviates allergic symptoms by increasing the ratio of Treg and Th17 cells.


CD39+ regulatory T cells accumulate in colon adenocarcinomas and display markers of increased suppressive function.

  • Filip Ahlmanner‎ et al.
  • Oncotarget‎
  • 2018‎

Increasing knowledge of the function and regulation of tumor-infiltrating lymphocytes has led to new insights in cancer immunotherapy. Regulatory T cells (Treg) accumulate in colon tumors, and we recently showed that CD39+ Treg from cancer patients inhibit transendothelial migration of conventional T cells. CD39 mediates the hydrolysis of ATP to immunosuppressive adenosine and adds to the immunosuppressive effects of Treg. Here, we further investigated the regulatory features of intratumoral CD39+ Treg in colon cancer. Using flow cytometry analyses of cells from 46 colon cancer patients, we confirm the accumulation of CD39+ Treg in the tumor tissue compared to unaffected colon tissue, and also show that tumor-infiltrating Treg express more CD39 and Foxp3 on a per cell basis. Furthermore, CD39+ Treg in tumors express markers indicating increased turnover and suppressive ability. In particular, tumor-infiltrating CD39+ Treg have high expression of surface molecules related to immunosuppression, such as ICOS, PD-L1 and CTLA-4. Functional suppression assays also indicate potent suppressive capacity of CD39+ Treg on proliferation and IFN-γ secretion by conventional T cells. In conclusion, our results identify tumor-infiltrating CD39+ Treg as a numerous and potentially important immunosuppressive subset, and suggest that immunotherapy aimed at reducing the activity of CD39+ Treg may be particularly useful in the setting of colon cancer.


Metformin alters H2A.Z dynamics and regulates androgen dependent prostate cancer progression.

  • Monica Tyagi‎ et al.
  • Oncotarget‎
  • 2018‎

Epigenetic mechanisms involved in prostate cancer include hypermethylation of tumor suppressor genes, general hypomethylation of the genome, and alterations in histone posttranslational modifications (PTMs). In addition, over expression of the histone variant H2A.Z as well as deregulated expression of Polycomb group proteins including EZH2 have been well-documented. Recent evidence supports a role for metformin in prostate cancer (PCa) treatment. However, the mechanism of action of metformin in PCa is poorly understood. We provide data showing that metformin epigenetically targets PCa by altering the levels and gene binding dynamics of histone variant H2A.Z. Moreover, we show that the increase in H2A.Z upon metformin treatment occurs preferentially due to H2A.Z.1 isoform. Chromatin immunoprecipitation (ChIP)-RT PCR analysis indicates that metformin treatment results in an increased H2A.Z occupancy on the androgen receptor (AR) and AR-regulated genes that is more prominent in the androgen dependent AR positive LNCaP cells. Repression of H2A.Z.1 gene by siRNA-mediated knock down identified this H2A.Z isoform to be responsible. Based on preliminary data with an EZH2-specific inhibitor, we suggest that the effects of metformin on the early stages of PCa may involve both EZH2 and H2A.Z through the alteration of different molecular pathways.


Transmembrane protein 108 involves in adult neurogenesis in the hippocampal dentate gyrus.

  • Zheng Yu‎ et al.
  • Cell & bioscience‎
  • 2019‎

Transmembrane protein 108 (Tmem108) is a risk gene of psychiatric diseases including schizophrenia, bipolar disorder and major depression disorder. However, the pathophysiological mechanisms of Tmem108 are largely unknown.


IL-33 ameliorates experimental colitis involving regulation of autophagy of macrophages in mice.

  • Zhongyan Wang‎ et al.
  • Cell & bioscience‎
  • 2019‎

Previously, we have demonstrated that IL-33 administration protecting TNBS-induced experimental colitis is associated with facilitation of Th2/Tregs responses in mice. However, whether IL-33 regulates autophagy to ameliorate experimental colitis is unclear.


Switching of biological therapies in Brazilian patients with rheumatoid arthritis.

  • Juliana Miranda de Lucena Valim‎ et al.
  • Future science OA‎
  • 2019‎

To assess drug switching, rates of remission and disease activity in Brazilian patients with rheumatoid arthritis (RA) treated with biologic agents.


Ultracentrifugation versus kit exosome isolation: nanoLC-MS and other tools reveal similar performance biomarkers, but also contaminations.

  • Frøydis Sved Skottvoll‎ et al.
  • Future science OA‎
  • 2019‎

For isolation of exosomes, differential ultracentrifugation and an isolation kit from a major vendor were compared.


Pharmacopuncture for Cervicogenic Dizziness.

  • Yunna Kim‎ et al.
  • Journal of pharmacopuncture‎
  • 2018‎

Pharmacopuncture is a treatment that medicinal fluid including herbal extract is injected in body under qi/flavor theory and meridian theories. There are a number of studies investigating the efficacy of pharmacopuncture for cervicogenic dizziness but its usage differs in each study. This study aimed to review previous studies of pharmacopuncture treatment for cervicogenic dizziness to navigate the direction of improvement.


  1. SPARC Anatomical Working Group Resources

    Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Facets

    Here are the facets that you can filter your papers by.

  9. Options

    From here we'll present any options for the literature, such as exporting your current results.

  10. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

Publications Per Year

X

Year:

Count: