Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
TX673 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035075 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00004027(pie-1) | WBGene00004027(pie-1) | WB-STRAIN:WBStrain00035075 | WormBase (WB) | WB | unknown | WB-STRAIN:TX673 | 2026-08-01 10:19:26 | 0 | |||
|
TX774 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035078 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00004027(pie-1) | WBGene00004027(pie-1) | WB-STRAIN:WBStrain00035078 | WormBase (WB) | WB | unknown | WB-STRAIN:TX774 | 2026-08-01 10:19:26 | 0 | |||
|
TX773 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035077 | Caenorhabditis elegans | teIs65 II; unc-119(ed3) III; him-3(e1147) IV. | teIs65 [pie-1p::GFP::plk-1(PBD) + unc-119(+)] II. Maintain at 25 degrees and by picking the most brightly fluorescing animals to avoid silencing of the transgene. teIs65 contains GFP fused to the PLK-1 protein-binding domain. Derived from injection of pRL1216. Reference: Nishi Y, et al. Development. 2008 Feb;135(4):687-97. | WBGene00001862(him-3)|WBGene00004027(pie-1)|WBGene00006843(unc-119) | WBGene00001862(him-3), WBGene00004027(pie-1), WBGene00006843(unc-119) | WB-STRAIN:WBStrain00035077 | WormBase (WB) | WB | available | WB-STRAIN:TX773, CGC_TX773 | 2026-08-01 10:19:24 | 0 | |||
|
TX796 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035081 | Caenorhabditis elegans | unc-119(ed3) III; him-3(e1147) IV; teEx321. | teEx321[pRL1636 (Pmed-1::GFP::sys-1) pDPmm016]. GFP signal is very weak and can't be see using a dissecting microscope. Very low transmission. Most signal is nuclear and the signal is stronger in the posterior sister, e.g., MSp stronger than MSa, Ep stronger than Ea. Some cortical signal was also detected. Some larvae lack anterior gut or have gaps. Maintain by picking non-Uncs. | WBGene00001862(him-3)|WBGene00006843(unc-119) | WBGene00001862(him-3), WBGene00006843(unc-119) | WB-STRAIN:WBStrain00035081 | WormBase (WB) | WB | available | WB-STRAIN:TX796, CGC_TX796 | 2026-08-01 10:19:26 | 0 | |||
|
TX787 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035080 | Caenorhabditis elegans | unc-119(ed3) III; him-3(e1147) IV; teIs70. | teIs70 [pie-1p::GFP::plk-1 + unc-119(+)] II. Maintain at 25 degrees and by picking the most brightly fluorescing animals to avoid silencing of the transgene. teIs70 contains GFP fused to full-length PLK-1. Derived from injection of pRL766. Reference: Nishi Y, et al. Development. 2008 Feb;135(4):687-97. | WBGene00001862(him-3)|WBGene00004027(pie-1)|WBGene00006843(unc-119) | WBGene00001862(him-3), WBGene00004027(pie-1), WBGene00006843(unc-119) | WB-STRAIN:WBStrain00035080 | WormBase (WB) | WB | unknown | WB-STRAIN:TX787 | 2026-08-01 10:19:24 | 0 | |||
|
TX903 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035083 | Caenorhabditis elegans | teIs90 I; unc-119(ed3) III; him-3(e1147) IV. | teIs90 [(pRL1483) pie-1p::GFP::taf-4 + unc119(+)]. Sick at high temperatures. Maintain at 20C, but it will silence after some generations. | WBGene00001862(him-3)|WBGene00006843(unc-119) | WBGene00001862(him-3), WBGene00006843(unc-119) | WB-STRAIN:WBStrain00035083 | WormBase (WB) | WB | available | WB-STRAIN:TX903, CGC_TX903 | 2026-08-01 10:19:24 | 0 | |||
|
TX1377 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035087 | Caenorhabditis elegans | unc-119(ed3) III; teIs127. | teIs127 [pie-1p::GFP::H2B::mom-2 3'UTR + unc-119(+)] teIs127 construct includes a 557 bp genomic sequence beginning 100 bp upstream of the mom-2 stop codon was cloned downstream of pie-1 promoter-driven GFP::H2B. Superficially wild-type. Reference: Oldenbroek M, et al. Development. 2013 Nov;140(22):4614-23. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00035087 | WormBase (WB) | WB | available | WB-STRAIN:TX1377, CGC_TX1377 | 2026-08-01 10:19:26 | 0 | |||
|
UA197 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035201 | Caenorhabditis elegans | EMPTY | EMPTY | WB-STRAIN:WBStrain00035201 | WormBase (WB) | WB | unknown | WB-STRAIN:UA197 | 2026-08-01 10:19:28 | 0 | |||||
|
TZ101 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035167 | Caenorhabditis elegans | pxf-1(pk1331) dpy-20(e1362) IV; pkEx10. | Mutagen:UV/TMP|"pkEx10 [T14G10 + dpy-20(+)]. Maintain by picking WT." | WBGene00001079(dpy-20)|WBGene00004254(pxf-1) | WBGene00001079(dpy-20), WBGene00004254(pxf-1) | WB-STRAIN:WBStrain00035167 | WormBase (WB) | WB | available | WB-STRAIN:TZ101, CGC_TZ101 | 2026-08-01 10:19:26 | 0 | |||
|
UA175 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035200 | Caenorhabditis elegans | [baInl32; Peat-4::ssABeta 1-42, Peat-4::gfp, Pmyo-2::mCherry]; baEx116; [Peat-4::lacZ, rol-6 (su1006)] | Generated by directly injecting 50 g/mL of putative ssABeta 1-42 toxicity modifiers and rol-6 into UA166 [baInl32; Peat-4::ssABeta 1-42, Peat-4::gfp, Pmyo-2::mCherry]. | WB-STRAIN:WBStrain00035200 | WormBase (WB) | WB | unknown | PMID:22033521 | WB-STRAIN:UA175 | 2026-08-01 10:19:26 | 0 | ||||
|
UA3 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035171 | Caenorhabditis elegans | Q19::GFP | EMPTY | WBGene00006598(tor-2)|WBGene00006789(unc-54) | WBGene00006598(tor-2), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00035171 | WormBase (WB) | WB | unknown | WB-STRAIN:UA3 | 2026-08-01 10:19:28 | 0 | |||
|
UA5 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035173 | Caenorhabditis elegans | Q19::GFP+TOR-2 | EMPTY | WBGene00006598(tor-2) | WBGene00006598(tor-2) | WB-STRAIN:WBStrain00035173 | WormBase (WB) | WB | unknown | WB-STRAIN:UA5 | 2026-08-01 10:19:26 | 0 | |||
|
UA38 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035177 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00006789(unc-54) | WBGene00006789(unc-54) | WB-STRAIN:WBStrain00035177 | WormBase (WB) | WB | unknown | WB-STRAIN:UA38 | 2026-08-01 10:19:28 | 0 | |||
|
UA8 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035176 | Caenorhabditis elegans | Q82::GFP+TOR-2(delta368) | EMPTY | WBGene00006598(tor-2) | WBGene00006598(tor-2) | WB-STRAIN:WBStrain00035176 | WormBase (WB) | WB | unknown | WB-STRAIN:UA8 | 2026-08-01 10:19:26 | 0 | |||
|
UA132 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035184 | Caenorhabditis elegans | EMPTY | EMPTY | WB-STRAIN:WBStrain00035184 | WormBase (WB) | WB | unknown | WB-STRAIN:UA132 | 2026-08-01 10:19:26 | 0 | |||||
|
UA57 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00035183 | Caenorhabditis elegans | baIs4. | baIs4 [dat-1p::GFP + dat-1p::CAT-2]. GFP expression in CEP, ADE and PDE neurons. From integration of baEx33.|"Made_by: Caldwell Lab"|"WBStrain mapped, WBPaper00060404 added based on AFP_Strain data." | WB-STRAIN:WBStrain00035183 | WormBase (WB) | WB | available | PMID:31323240 | WB-STRAIN:UA57, CGC_UA57 | 2026-08-01 10:19:28 | 5 | ||||
|
UA134 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035186 | Caenorhabditis elegans | EMPTY | EMPTY | WB-STRAIN:WBStrain00035186 | WormBase (WB) | WB | unknown | WB-STRAIN:UA134 | 2026-08-01 10:19:28 | 0 | |||||
|
UA133 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035185 | Caenorhabditis elegans | EMPTY | EMPTY | WB-STRAIN:WBStrain00035185 | WormBase (WB) | WB | unknown | WB-STRAIN:UA133 | 2026-08-01 10:19:26 | 0 | |||||
|
TY3558 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035144 | Caenorhabditis elegans | unc-119(ed3) ruIs32 III; ojIs1. | ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Histone and tubulin GFP. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00035144 | WormBase (WB) | WB | available | PMID:26024448 | WB-STRAIN:TY3558, CGC_TY3558 | 2026-08-01 10:19:27 | 0 | ||
|
TY3579 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035145 | Caenorhabditis elegans | sea-1(y356) II. | Wild type phenotype. In order to identify the correct genotype, JRP93 catttgtctagaactgtcattctgtc; and JRP106 gatctccatttgccggcaaattctcc primers are used to produce a 486 bp amplicon that can be sequenced with either primer for confirmation of the sea-1(y356) lesion (C to T at +97). The sea-1(y356) mutation is covered by the balancer mIn1[dpy-10(e128) mIs14], which is often used in construction of sea-1(y356) containing strains. | WBGene00004750(sea-1) | WBGene00004750(sea-1) | WB-STRAIN:WBStrain00035145 | WormBase (WB) | WB | available | WB-STRAIN:TY3579, CGC_TY3579 | 2026-08-01 10:19:25 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
