The expression of secreted protein acidic and rich in cysteine (SPARC) has been recently identified to be associated with the pathology of diabetic retinopathy. Therefore, the present study aimed to evaluate the regulatory role of SPARC in human retinal capillary endothelial cells (HRCECs), following exposure to a high glucose environment in vitro. The cell viability, migration, angiogenesis, permeability and SPARC expression levels of HRCECs were measured following treatment with different concentrations of glucose (25, 50 or 100 mM). Lentiviral vectors (LV185-pL_shRNA_mKate2-SPARC-543; target sequence, GGATGAGGACAACAACCTTCT) that inhibit the expression of SPARC were constructed, and HRCECs were evaluated when infected by viruses carrying the lentiviral vectors. Cell viability was examined using the Cell Counting Kit-8 assay. The expression of SPARC in HRCECs increased as the concentration of glucose in the culture medium increased. Relatively high concentrations of glucose significantly inhibited cell proliferation (P<0.05), migration (P<0.05), angiogenesis (P<0.01), and the expression of ZO, occludin, claudin and JAM1 in tight junctions (P<0.01), gap junctions (Cx37 and Cx43; P<0.01) and adherens junctions (VE-cadherin, CTNNA1 and CTNNB1; P<0.05). However, when SPARC was downregulated by lentiviral vectors, the inhibitions induced by high concentrations of glucose were partially reversed. To conclude, the inhibitory effects on cell viability, migration, angiogenesis and cellular adhesion of HRCECs induced by high concentrations of glucose were reversed once the expression of SPARC was inhibited. These findings suggest that SPARC may serve an important role in pathogenesis of diabetic retinopathy.

WRKY transcription factors have been extensively characterized in the past 20 years, but in wheat, studies on WRKY genes and their function are lagging behind many other species. To explore the function of wheat WRKY genes, we identified a TaWRKY68 gene from a common wheat cultivar. It encodes a protein comprising 313 amino acids which harbors 19 conserved motifs or active sites. Gene expression patterns were determined by analyzing microarray data of TaWRKY68 in wheat and of orthologous genes from maize, rice and barley using Genevestigator. TaWRKY68 orthologs were identified and clustered using DELTA-BLAST and COBALT programs available at NCBI. The results showed that these genes, which are expressed in all tissues tested, had relatively higher levels in the roots and were up-regulated in response to biotic stresses. Bioinformatics results were confirmed by RT-PCR experiments using wheat plants infected by Agrobacterium tumefaciens and Blumeria graminis, or treated with Deoxynivalenol, a Fusarium graminearum-induced mycotoxin in wheat or barley. In summary, TaWRKY68 functions differ during plant developmental stages and might be representing a hub gene function in wheat responses to various biotic stresses. It was also found that including data from major cereal genes in the bioinformatics analysis gave more accurate and comprehensive predictions of wheat gene functions.

In Escherichia coli, 12 distinct RNA structures within the transcripts encoding ribosomal proteins interact with specific ribosomal proteins to allow autogenous regulation of expression from large multi-gene operons, thus coordinating ribosomal protein biosynthesis across multiple operons. However, these RNA structures are typically not represented in the RNA Families Database or annotated in genomic sequences databases, and their phylogenetic distribution is largely unknown. To investigate the extent to which these RNA structures are conserved across eubacterial phyla, we created multiple sequence alignments representing 10 of these messenger RNA (mRNA) structures in E. coli. We find that while three RNA structures are widely distributed across many phyla of bacteria, seven of the RNAs are narrowly distributed to a few orders of Gammaproteobacteria. To experimentally validate our computational predictions, we biochemically confirmed dual L1-binding sites identified in many Firmicute species. This work reveals that RNA-based regulation of ribosomal protein biosynthesis is used in nearly all eubacterial phyla, but the specific RNA structures that regulate ribosomal protein biosynthesis in E. coli are narrowly distributed. These results highlight the limits of our knowledge regarding ribosomal protein biosynthesis regulation outside of E. coli, and the potential for alternative RNA structures responsible for regulating ribosomal proteins in other eubacteria.

MYB protooncogene-like 2 (MYBL2) is a transcription factor that is upregulated and significantly associated with various human cancer types. However, the potential role of MYBL2 in clear cell renal cell carcinoma (ccRCC) is yet to be elucidated. Therefore, the expression and biological functions of MYBL2 in ccRCC were assessed in the current study using The Cancer Genome Atlas (TCGA). A Wilcoxon signed-rank test was performed to compare MYBL2 expression between ccRCC and normal tissues. Moreover, the association between MYBL2 expression and various clinicopathological factors was estimated using both the Wilcoxon signed-rank test and logistic regression. The differences in prognosis between patients with high- and low-MYBL2 expression were analyzed via the Kaplan-Meier method and Cox regression analysis. Finally, gene set enrichment analysis (GSEA) was performed to investigate the biofunctions of MYBL2 in ccRCC. It was revealed that MYBL2 was upregulated in ccRCC, and that the MYBL2 high-expression phenotype was significantly associated with sex, a high histological grade, an advanced clinical stage, tumor stage, lymph node metastasis, distant metastasis and poor overall survival (OS). It was also revealed, via the Cox regression analysis, that the upregulation of MYBL2 expression was able to independently predict a poor prognosis in patients with ccRCC. GSEA indicated that the intestinal immune network for IgA production, primary immunodeficiency, the janus kinase (JAK)-signal transducer and activator of transcription (STAT) signaling pathway, the cytosolic DNA-sensing pathway, the p53 signaling pathway and the chemokine signaling pathway were all enriched in the high-MYBL2 expression datasets. In conclusion, the present findings indicate that MYBL2 may be used as an independent prognostic factor in patients with ccRCC.

Diabetes is a chronic metabolic disease characterized by insulin resistance (IR). SHP2 has previously been identified as a potential target to reduce IR in diabetes. Here, we examined the effects of SHP2 on glucose consumption (GC), IR level and the expression of insulin receptor substrate (IRS), AKT and extracellular signal-regulated kinase (ERK)1/2 proteins in a cellular and animal model of diabetes. IR was induced in hepatocellular carcinoma (HCC) cells, and SHP2 was up-regulated or down-regulated in cells. Diabetic rats were treated with SHP2 inhibitor. GC of cells, and the weight, total cholesterol, triglycerides, fasting blood glucose, fasting insulin, homeostasis model assessment-IR index and insulin sensitivity (ISI) of the rats were analyzed. The levels of SHP2 and the activation of IRS-2, AKT and ERK1/2 in cells and rats were measured by quantitative real-time PCR (qRT-PCR) or western blot. GC was reduced, but expression of SHP2 was enhanced in IR HCC cells. Phosphorylation of IRS-2 and AKT in IR HCC cells and diabetic rats was decreased, whereas phosphorylation of ERK1/2 was enhanced. In both the cell and animal models, SHP2 knockdown enhanced GC, ameliorated IR, activated IRS-2 and AKT, and inhibited ERK1/2 phosphorylation, in contrast with the effects of SHP2 overexpression. SHP2 knockdown may enhance GC and ameliorate IR through phosphorylation of IRS-2 via regulating AKT and ERK1/2 in liver.

The aim of the work was to investigate the effects of acacetin on endothelial dysfunction and aortic fibrosis in insulin-resistant SHR rats and explore its mechanism. Seven-week-old male spontaneously hypertensive rats (SHR) were selected to establish a rat model of hypertension with insulin resistance induced by 10% fructose. The nuclear factor kappa B p65 (NF-κB p65) and Collagen I were observed by Immunohistochemistry. Immunofluorescence was used to observe estrogen receptor-alpha (ERα), estrogen receptor-beta (ERβ), and G protein-coupled receptor 30 (GPR30). Western blotting was used to detect interleukin (IL-1β), Arginase 2 (ARG2), Nostrin, endothelial nitric oxide synthase (eNOS), TGF-β, Smad3, ERK pathway proteins such as p-c-Raf, p-MEK1/2, p-ERK, ERK, p-P90RSK and p-MSK1. We found that acacetin did have an improvement on endothelial dysfunction and fibrosis. Meanwhile, it was also found to have a significant effect on the level of estrogen in this model by accident. Then, the experiment of uterine weight gain in mice confirmed that acacetin had a certain estrogen-like effect in vivo and played its role through the estrogen receptors pathway. In vitro experience HUVEC cells were stimulated with 30 mM/L glucose and 100 mM/L NaCl for 24 h to establish the endothelial cell injury model. HUVEC cells were treated with 1 μM/L estrogen receptors antagonist (ICI 182780) for 30 min before administration. Cell experiments showed that acacetin could reduce the apoptosis of HUVEC cells, the levels of inflammatory cytokines and the expression of TGF-β, Collagen I and Smad3 in endothelial cell injury model. After treatment with ICI 182780, the improvement of acacetin was significantly reversed. The results showed that acacetin relieved endothelial dysfunction and reduced the aortic fibrosis in insulin-resistant SHR rats by reducing the release of inflammatory factors and improving vasodilatory function through estrogen signaling pathway.

Adrenocortical carcinoma (ACC) is considered a rare tumor with a dismal prognosis. Expression of immune-related genes (IRGs) in ACC and correlations between IRGs and ACC prognosis were assessed using The Cancer Genome Atlas (TCGA) and Genotype-Tissue Expression (GTEx) databases.

SIRT6, NAD+-dependent deacetylase sirtuin 6, has recently shown to suppress tumor growth in several types of cancer. Colon cancer is a challenging carcinoma associated with high morbidity and death. However, whether SIRT6 play a direct role in colon tumorigenesis and the underlying mechanism are not understood. Methods: To investigate the role of SIRT6 in colon cancer, we firstly analyzed the specimens from 50 colorectal cancer (CRC) patients. We generated shSIRT6 LoVo cells and xenograft mouse to reveal the essential role of SIRT6 in cell apoptosis and tumor growth. To explore the underlying mechanism of SIRT6 regulation, we performed FRET and real-time fluorescence imaging in living cells, real-time PCR, immunoprecipitaion, immunohistochemistry, flow cytometry and luciferase reporter assay. Results: The expression level of SIRT6 in patients' specimens is lower than that of normal controls, and patients with higher SIRT6 level have a better prognosis. Here, we identified that transcriptional factor FoxO3a is a direct up-stream of SIRT6 and positively regulated SIRT6 expression, which in turn, promotes apoptosis by activating Bax and mitochondrial pathway. Functional studies reveal that Akt inactivation increases FoxO3a activity and augment its binding to SIRT6 promoter, leading to elevated SIRT6 expression. Knocking down SIRT6 abolished apoptotic responses and conferred resistance to the treatment of BKM120. Combinational therapies with conventional drugs showed synergistic chemosensitization, which was SIRT6-dependent both in vitro and in vivo. Conclusion: The results uncover SIRT6 as a new potential biomarker for colon cancer, and its unappreciated mechanism about transcription and expression via Akt/FoxO3a pathway.

Many Gram-negative bacterial pathogens utilize the type III secretion system (T3SS) to inject virulence factors, named effectors, into host cells. These T3SS effectors manipulate host cellular signaling pathways to facilitate bacterial pathogenesis. Death receptor signaling plays an important role in eukaryotic cell death pathways. NleB from enteropathogenic Escherichia coli (EPEC) and SseK1/3 from Salmonella enterica serovar Typhimurium (S. Typhimurium) are T3SS effectors. They are defined as a family of arginine GlcNAc transferase to modify a conserved arginine residue in the death domain (DD) of the death receptor TNFR and their corresponding adaptors to hijack death receptor signaling. Here we identified that these enzymes, NleB, SseK1, and SseK3 could catalyze auto-GlcNAcylation. Residues, including Arg13/53/159/293 in NleB, Arg30/158/339 in SseK1, and Arg153/184/305/335 in SseK3 were identified as the auto-GlcNAcylation sites by mass spectrometry. Mutation of the auto-modification sites of NleB, SseK1, and SseK3 abolished or attenuated the capability of enzyme activity toward their death domain targets during infection. Loss of this ability led to the increased susceptibility of the cells to TNF- or TRAIL-induced cell death during bacterial infection. Overall, our study reveals that the auto-GlcNAcylation of NleB, SseK1, and SseK3 is crucial for their biological activity during infection.

Colon adenocarcinoma (COAD) is one of the most common gastrointestinal malignant tumors and is characterized by a high mortality rate. Here, we integrated whole-exome and RNA sequencing data from The Cancer Genome Atlas and investigated the mutational spectra of COAD-overexpressed genes to define clinically relevant diagnostic/prognostic signatures and to unmask functional relationships with both tumor-infiltrating immune cells and regulatory miRNAs. We identified 24 recurrently mutated genes (frequency > 5%) encoding putative COAD-specific neoantigens. Five of them (NEB, DNAH2, ABCA12, CENPF and CELSR1) had not been previously reported as COAD biomarkers. Through machine learning-based feature selection, four early-stage-related (COL11A1, TG, SOX9, and DNAH2) and four late-stage-related (COL11A1, SOX9, TG and BRCA2) candidate neoantigen-encoding genes were selected as diagnostic signatures. They respectively showed 100% and 97% accuracy in predicting early- and late-stage patients, and an 8-gene signature had excellent prognostic performance predicting disease-free survival (DFS) in COAD patients. We also found significant correlations between the 24 candidate neoantigen genes and the abundance and/or activation status of 22 tumor-infiltrating immune cell types and 56 regulatory miRNAs. Our novel neoantigen-based signatures may improve diagnostic and prognostic accuracy and help design targeted immunotherapies for COAD treatment.

The frog-in-the-pan (FIP) phenomenon suggests that investors are more sensitive to abrupt price changes than gradual price changes in the stock market. Based on the cognitive-evolutionary model of surprise and the reinforcement learning model, this paper provides a new explanation for the FIP phenomenon in that this phenomenon could be explained by the elicitation of surprise emotion. We predict that when a change substantially and abruptly occurs, the significant prediction error triggers participants' surprise, which makes participants more sensitive to the change. To ascertain these hypotheses, we recruited 109 participants and compared participants' learning rates and surprise responses under different contexts. We observed that participants' learning rate soared when the prediction error was large enough to trigger surprise emotion under abruptly changed conditions and confirmed that the FIP phenomenon could be explained by the elicitation of surprise emotion. In a word, this research demonstrates the significant role of surprise emotion in the decision-making process.

Small nucleolar RNA host gene 1 (SNHG1) is critical in the progression of cancers. However, the mechanism by which SNHG1 regulates the progression of colorectal cancer (CRC) remains unclear. Expressions of SNHG1 and miR-137 in CRC tissues and cell lines were evaluated by quantitative real-time polymerase chain reaction. A luciferase reporter gene assay was conducted to investigate miR-137 target. Additionally, RNA pull-down assay was performed to explore the physical association between miR-137, SNHG1, and RNA induced silencing complex (RISC). Cell cycling and invasion were examined by flow cytometry (FCM) and transwell assays. The in vivo carcinogenic activity of SNHG1 was examined using murine xenograft models. Expression of RICTOR, serine/threonine kinase 1 (AKT), serum and glucocorticoid-inducible kinase 1 (SGK1), p70S6K1, and LC3II/LC3I ratio was examined by Western blot analysis. SNHG1 upregulation was observed in CRC tissues and cell lines, which was associated with the lymph node metastasis, advanced TNM stage and poorer prognosis. SNHG1 increased RICTOR level in CRC via sponging miR-137. In addition, SNHG1 silencing inhibited CRC cell proliferation and migration in vitro and in vivo. SNHG1 regulated RICTOR expression by sponging miR-137 and promoted tumorgenesis in CRC.

This study aimed to investigate the glucose and lipid metabolism improving effect of the total flavonoids from Selaginella tamariscina (Beauv.) Spring (TFST) on db/db mice, and to study its mechanism of action.

Bone mesenchymal stem cells (BMSCs)-derived exosomes (Exos) play important roles in osteoporosis, while the regulation of microRNA (miR)-21-5p remains unclear. The BMSCs-derived exosomes were isolated from femoral bone marrow of trauma patients, which were then used to stimulate human osteoblasts (hFOB1.19 cells). The miR-21-5p mimic or inhibitor was transfected into BMSCs to overexpress or knockdown miR-21-5p. The functions of miR-21-5p in osteoporosis were assessed by cell counting kit-8 (CCK-8) assay, alkaline phosphatase (ALP) staining and alizarin red staining assays. We found that BMSCs-derived exosomes could enhance proliferation, osteoblastic differentiation and ALP activity of hFOB1.19 cells. BMSCs-derived exosomes with upregulated miR-21-5p could further enhance these protective impacts compared with that in BMSCs-derived exosomes, while BMSCs-derived exosomes with downregulated miR-21-5p reduced these cell phenotypes. MiR-21-5p could directly bind to the 3'-untranslated region (UTR) of Kruppel-like factor 3 (KLF3), and knockdown of KLF3 obviously attenuated these inhibitory effects of BMSCs-derived exosomes with downregulated miR-21-5p on osteoblastic differentiation and ALP activity of hFOB1.19 cells. In summary, BMSCs-derived exosomal miR-21-5p improved osteoporosis through regulating KLF3, providing a potential therapeutic strategy for osteoporosis.

Melanoma is a highly aggressive tumor located in the skin, with limited traditional therapies. In order to reduce the side effects caused by traditional administration method and amplify the killing effect of immune system against tumor cells, an in situ injectable hydrogel drug delivery system is developed for the first time which co-delivers doxorubicin (Dox) and imiquimod (R837) for the synergistic therapy of melanoma. The mechanical properties and stability of the hydrogel are characterized and the optimal doses of hydrogel and drugs are also identified. As a result, the co-delivery system effectively suppresses melanoma growth and metastatic progression both in vitro and in vivo. Further studies show that the co-delivery system causes immunogenic cell death, activation of antigen presenting cells, comprising dendritic cells and M1 macrophages, and secretion of related cytokines consisted of tumor necrosis factor-α (TNF-α) and interferon-γ (IFN-γ), subsequently with the activation of T lymphocytes and natural killer cells in spleen and tumor area. The co-delivery system also decreases the suppressive immune responses, including infiltration of M2 macrophages and secretion of interleukin-10 (IL-10), in vivo. Besides, other death modes are induced by the co-delivery system, including apoptosis and non-apoptotic cell death. In a word, this co-delivery system induces melanoma cell death directly and activates immune system for further tumor killing simultaneously, which shows probability for precise targeted tumor therapy.

Acute pancreatitis (AP) is usually accompanied by intestinal failure, but its mechanism is still unclear. In AP patients, the functions of Paneth cells (lysozyme, HD5, Reg3γ, and Wnt3a) decreased. Compared with AP mice, injuries and inflammation of the pancreas and ileum were aggravated in AP mice treated with dithizone (Dith) (Dith+AP mice). Intestinal permeability and bacterial translocation were also increased. 16S rRNA sequencing showed that the gut microbiota of Dith mice and Dith+AP mice exhibited a marked increase in the pathogenic bacterium Helicobacter and a significant decrease in the probiotic bacterium Blautia. Lysozyme gavage in Dith+AP mice effectively alleviated injuries of the pancreas and small intestine. The beneficial effect of lysozyme was associated with a significant increase in the probiotic bacterium Blautia and a virtual absence of the pathogenic bacterium Helicobacter. The severity of AP in antibiotic-treated mice (ABX mice) was significantly aggravated when receiving feces from Dith mice and was markedly alleviated when receiving feces from lysozyme-gavaged mice. In vitro, lysozyme increased the proliferation of enteroids by promoting the activation of the Wnt pathway and Lgr5 expression in intestinal stem cells. IMPORTANCE We demonstrate that AP patients and experimental AP mice exhibited a dysfunction of Paneth cells. Our in vivo research showed that the severity of AP was exacerbated by the long-term dysfunction of Paneth cells, which was associated with gut microbiota disorder. Restoring part of Paneth cell functions through lysozyme supplementation alleviated the severity of AP and gut microbiota dysbiosis. This study provides novel insight into the link of pancreas-gut interactions in the pathogenesis of AP, providing a new direction for the clinical treatment of intestinal complications during AP.

Cucurbitacins have a variety of bioactivities, such as anticancer, anti-inflammatory, antidepressant-like, and antiviral effects, but their pharmacological effect in ulcerative colitis (UC) has not been reported until now. Thus, this study aims to investigate the preventive effects of Xuedan sustained release pellets (XSPs) on UC rats and the underlying mechanisms. XSPs were prepared by extracting cucurbitacins from Hemsleya. Experimental UC rats were induced by the intake of 4% dextran sulfate sodium (DSS) for a week and treated with different doses of XSP (0.95, 1.90, and 3.8 mg/kg). The body weight, colon length, disease activity index (DAI), and histological changes of colonic tissue were measured. In addition, the expressions of pro-inflammatory cytokines were detected by using the enzyme-linked immunosorbent assay. Pathways involved in the intestinal inflammation were targeted by RNA-sequencing. Moreover, the changes of gut microbial diversity and composition were analyzed by the 16SrNA analysis and the contents of short-chain fatty acids (SCFAs) were detected by GC-MS. The results revealed that XSP intervention greatly restored the weight loss and colonic shortening (p < 0.05) and reduced the raised DAI scores, myeloperoxidase, and nitric oxide activities in UC in rats (p < 0.05). XSP administration also downregulated the protein levels of pro-inflammatory factors IL-1β, IL-6, and TNF-α. Notably, it was found that XSP considerably suppressed the activation of the MAPK signaling pathway. In addition, XSP treatment improved the balance of gut microbiota that was disturbed by DSS. The beneficial bacteria Lachnospiraceae_NK4A136 group and Lactobacillus at the genus level significantly increased in the XSP group, which had decreased with the use of DSS (p < 0.05). Pathogenic bacteria including Escherichia-Shigella and Bacteroides in UC in rats were reduced by XSP intervention. Furthermore, XSP significantly elevated the production of SCFAs in UC in rats (p < 0.05). These alterations in inflammatory status were accompanied with changes in gut microbiota diversity and SCFA production. In conclusion, XSP exhibited protective effects against DSS-induced UC in rats. XSP treatment decreased inflammation via modulation of gut microbiota composition and SCFA production.

Chordomas are low-grade malignancies accounting for 1-4% of primary bone malignancies. Moreover, local recurrences increase the rate of metastasis. Our previous study identified the far upstream element (FUSE)-binding protein 1 (FUBP1) as a biomarker and potential therapeutic target for chordoma. In this study, lncRNA KRT8P41 was identified as a lncRNA positively correlated with FUBP1. In chordoma patients, higher lncRNA KRT8P41 expression was correlated with a poorer prognosis. LncRNA KRT8P41 silencing significantly inhibited chordoma cell proliferation and invasion. miR-193a was negatively correlated with lncRNA KRT8P41 and FUBP1; lncRNA KRT8P41 inhibited miR-193a expression, and miR-193a inhibited FUBP1 expression. Furthermore, miR-193a directly bound to lncRNA KRT8P41 and FUBP1 and lncRNA KRT8P41 competed with FUBP1 for miR-193a binding and relieved miR-193a-mediated FUBP1 inhibition. LncRNA KRT8P41 silencing inhibited, whereas miR-193a inhibition promoted chordoma cell proliferation and invasion; the inhibition of miR-193a attenuated the roles of lncRNA KRT8P41. Within chordoma tissues, the expression of miR-193a was decreased, and the expression of FUBP1 increased compared to normal control tissues. LncRNA KRT8P41 exhibited a positive correlation with FUBP1 and a negative correlation with miR-193a in vivo. Therefore, it was concluded that lncRNA KRT8P41, miR-193a-3p, and FUBP1 form a lncRNA-miRNA-mRNA axis, modulating the proliferation and invasion of chordoma cells.

Venous neointimal hyperplasia can be a problem after vein interventions. We hypothesized that inhibiting programmed death-1 (PD-1) can decrease venous neointimal hyperplasia in a rat inferior vena cava (IVC) patch venoplasty model. The rats were divided into four groups: the control group was only decellularized without other special treatment; the PD-1 group was injected with a single dose of humanized PD-1 antibody (4 mg/kg); the PD-1 antibody coated patches group; the BMS-1 (a PD-1 small molecular inhibitor) coated patches group (PD-1 inhibitor-1). Patches were implanted to the rat IVC and harvested on day 14 and analyzed. Immunohistochemical analysis showed PD-1-positive cells in the neointima in the human samples. There was high protein expression of PD-1 in the neointima in the rat IVC venoplasty model. PD-1 antibody injection can significantly decrease neointimal thickness (p < 0.0001). PD-1 antibody or BMS-1 was successfully conjugated to the decellularized rat thoracic artery patch by hyaluronic acid with altered morphology and reduced the water contact angle (WCA). Patches coated with humanized PD-1 antibody or BMS-1 both can also decrease neointimal hyperplasia and inflammatory cells infiltration. PD-1-positive cells are present in venous neointima in both human and rat samples. Inhibition of the PD-1 pathway may be a promising therapeutic strategy to inhibit venous neointimal hyperplasia.

Hypertension is closely related to myocardial injury. Long-term hypertension can cause myocardial injury. Therefore, it is very important to find drugs to treat myocardial injury caused by hypertension. The aim of present study is to investigate the effects and mechanisms of geniposide on myocardial injuries in spontaneously hypertensive rats (SHR) and H9c2 cells induced by NaCl solution.