This service exclusively searches for literature that cites resources. Please be aware that the total number of searchable documents is limited to those containing RRIDs and does not include all open-access literature.
WRKY transcription factors have been extensively characterized in the past 20 years, but in wheat, studies on WRKY genes and their function are lagging behind many other species. To explore the function of wheat WRKY genes, we identified a TaWRKY68 gene from a common wheat cultivar. It encodes a protein comprising 313 amino acids which harbors 19 conserved motifs or active sites. Gene expression patterns were determined by analyzing microarray data of TaWRKY68 in wheat and of orthologous genes from maize, rice and barley using Genevestigator. TaWRKY68 orthologs were identified and clustered using DELTA-BLAST and COBALT programs available at NCBI. The results showed that these genes, which are expressed in all tissues tested, had relatively higher levels in the roots and were up-regulated in response to biotic stresses. Bioinformatics results were confirmed by RT-PCR experiments using wheat plants infected by Agrobacterium tumefaciens and Blumeria graminis, or treated with Deoxynivalenol, a Fusarium graminearum-induced mycotoxin in wheat or barley. In summary, TaWRKY68 functions differ during plant developmental stages and might be representing a hub gene function in wheat responses to various biotic stresses. It was also found that including data from major cereal genes in the bioinformatics analysis gave more accurate and comprehensive predictions of wheat gene functions.
In Escherichia coli, 12 distinct RNA structures within the transcripts encoding ribosomal proteins interact with specific ribosomal proteins to allow autogenous regulation of expression from large multi-gene operons, thus coordinating ribosomal protein biosynthesis across multiple operons. However, these RNA structures are typically not represented in the RNA Families Database or annotated in genomic sequences databases, and their phylogenetic distribution is largely unknown. To investigate the extent to which these RNA structures are conserved across eubacterial phyla, we created multiple sequence alignments representing 10 of these messenger RNA (mRNA) structures in E. coli. We find that while three RNA structures are widely distributed across many phyla of bacteria, seven of the RNAs are narrowly distributed to a few orders of Gammaproteobacteria. To experimentally validate our computational predictions, we biochemically confirmed dual L1-binding sites identified in many Firmicute species. This work reveals that RNA-based regulation of ribosomal protein biosynthesis is used in nearly all eubacterial phyla, but the specific RNA structures that regulate ribosomal protein biosynthesis in E. coli are narrowly distributed. These results highlight the limits of our knowledge regarding ribosomal protein biosynthesis regulation outside of E. coli, and the potential for alternative RNA structures responsible for regulating ribosomal proteins in other eubacteria.
The expression of secreted protein acidic and rich in cysteine (SPARC) has been recently identified to be associated with the pathology of diabetic retinopathy. Therefore, the present study aimed to evaluate the regulatory role of SPARC in human retinal capillary endothelial cells (HRCECs), following exposure to a high glucose environment in vitro. The cell viability, migration, angiogenesis, permeability and SPARC expression levels of HRCECs were measured following treatment with different concentrations of glucose (25, 50 or 100 mM). Lentiviral vectors (LV185-pL_shRNA_mKate2-SPARC-543; target sequence, GGATGAGGACAACAACCTTCT) that inhibit the expression of SPARC were constructed, and HRCECs were evaluated when infected by viruses carrying the lentiviral vectors. Cell viability was examined using the Cell Counting Kit-8 assay. The expression of SPARC in HRCECs increased as the concentration of glucose in the culture medium increased. Relatively high concentrations of glucose significantly inhibited cell proliferation (P<0.05), migration (P<0.05), angiogenesis (P<0.01), and the expression of ZO, occludin, claudin and JAM1 in tight junctions (P<0.01), gap junctions (Cx37 and Cx43; P<0.01) and adherens junctions (VE-cadherin, CTNNA1 and CTNNB1; P<0.05). However, when SPARC was downregulated by lentiviral vectors, the inhibitions induced by high concentrations of glucose were partially reversed. To conclude, the inhibitory effects on cell viability, migration, angiogenesis and cellular adhesion of HRCECs induced by high concentrations of glucose were reversed once the expression of SPARC was inhibited. These findings suggest that SPARC may serve an important role in pathogenesis of diabetic retinopathy.
Trauma-induced osteonecrosis of the femoral head (TIONFH) is a major complication of femoral neck fractures. Degeneration and necrosis of subchondral bone can cause collapse, which results in hip joint dysfunction in patients. The destruction of bone metabolism homeostasis is an important factor for osteonecrosis. MicroRNAs (miRNAs) have an important role in regulating osteogenic differentiation, but the mechanisms underlying abnormal bone metabolism of TIONFH are poorly understood. In this study, we screened specific miRNAs in TIONFH by microarray and further explored the mechanism of osteogenic differentiation.
Small nucleolar RNA host gene 1 (SNHG1) is critical in the progression of cancers. However, the mechanism by which SNHG1 regulates the progression of colorectal cancer (CRC) remains unclear. Expressions of SNHG1 and miR-137 in CRC tissues and cell lines were evaluated by quantitative real-time polymerase chain reaction. A luciferase reporter gene assay was conducted to investigate miR-137 target. Additionally, RNA pull-down assay was performed to explore the physical association between miR-137, SNHG1, and RNA induced silencing complex (RISC). Cell cycling and invasion were examined by flow cytometry (FCM) and transwell assays. The in vivo carcinogenic activity of SNHG1 was examined using murine xenograft models. Expression of RICTOR, serine/threonine kinase 1 (AKT), serum and glucocorticoid-inducible kinase 1 (SGK1), p70S6K1, and LC3II/LC3I ratio was examined by Western blot analysis. SNHG1 upregulation was observed in CRC tissues and cell lines, which was associated with the lymph node metastasis, advanced TNM stage and poorer prognosis. SNHG1 increased RICTOR level in CRC via sponging miR-137. In addition, SNHG1 silencing inhibited CRC cell proliferation and migration in vitro and in vivo. SNHG1 regulated RICTOR expression by sponging miR-137 and promoted tumorgenesis in CRC.
SIRT6, NAD+-dependent deacetylase sirtuin 6, has recently shown to suppress tumor growth in several types of cancer. Colon cancer is a challenging carcinoma associated with high morbidity and death. However, whether SIRT6 play a direct role in colon tumorigenesis and the underlying mechanism are not understood. Methods: To investigate the role of SIRT6 in colon cancer, we firstly analyzed the specimens from 50 colorectal cancer (CRC) patients. We generated shSIRT6 LoVo cells and xenograft mouse to reveal the essential role of SIRT6 in cell apoptosis and tumor growth. To explore the underlying mechanism of SIRT6 regulation, we performed FRET and real-time fluorescence imaging in living cells, real-time PCR, immunoprecipitaion, immunohistochemistry, flow cytometry and luciferase reporter assay. Results: The expression level of SIRT6 in patients' specimens is lower than that of normal controls, and patients with higher SIRT6 level have a better prognosis. Here, we identified that transcriptional factor FoxO3a is a direct up-stream of SIRT6 and positively regulated SIRT6 expression, which in turn, promotes apoptosis by activating Bax and mitochondrial pathway. Functional studies reveal that Akt inactivation increases FoxO3a activity and augment its binding to SIRT6 promoter, leading to elevated SIRT6 expression. Knocking down SIRT6 abolished apoptotic responses and conferred resistance to the treatment of BKM120. Combinational therapies with conventional drugs showed synergistic chemosensitization, which was SIRT6-dependent both in vitro and in vivo. Conclusion: The results uncover SIRT6 as a new potential biomarker for colon cancer, and its unappreciated mechanism about transcription and expression via Akt/FoxO3a pathway.
MicroRNAs (miRNAs) are important regulators involved in the antiviral response to influenza virus infection, however, an analytical comparison of miRNA and mRNA expression changes induced by several H7N9 host-adapting PB2 mutants remains undone. Here, miRNA microarray and transcriptome sequencing of BALB/c mouse lungs infected with A/Anhui/1/2013 (H7N9) [hereafter referred to as H7N9/AH1-PB2-627K(WT)] and mutant variants with PB2 amino acid substitutions (avian-like H7N9/AH1-PB2-627E and mammalian-adapted H7N9/AH1-PB2-627E/701N) were directly compared. The results showed that influenza virus infection induced dysregulation of numerous host cell processes. In a miRNA-mRNA network associated with immunity, changes in the expression of 38 miRNAs and 58 mRNAs were detected following influenza virus infection. Notably, the miRNAs of mmu-miR-188-5p, mmu-miR-511-5p, mmu-miR-483-5p, and mmu-miR-690 were specifically associated with the replication of the avian-like virus H7N9/AH1-PB2-627E. Likewise, the miRNAs of mmu-miR-691, mmu-miR-329-3p, and mmu-miR-144-3p were specifically associated with the mammalian-adapted virus H7N9/AH1-PB2-627E/701N. Finally, the miRNAs of mmu-miR-98-5p, mmu-miR-103-3p, mmu-miR-199a-5p, and mmu-miR-378a-3p were specifically associated with H7N9/AH1-PB2-627K(WT) virus replication. This is the first report of comparative integration analysis of miRNA-mRNA expression of these three H7N9 influenza viruses with different host-adapting PB2 mutations. Our results highlight potential miRNAs of importance in influenza virus pathogenesis.
The application of fire-retardant fabrics is essential for providing thermal protective function of the garments. Appropriate clothing design are beneficial for preventing the wearers from skin burn injuries and heat strains simultaneously. The intention of this work was to investigate the effects of clothing ventilation designs on its thermal protective performance by bench-scale tests. Four boundary conditions were designed to simulate the garment aperture structures on fabric level. Tests of thermal shrinkage, mass loss and time-to-second-degree-burns were performed with and without air gap under three heat-flux levels for two kinds of inherently fire-retardant fabrics. The impacts of fabric type, heat-flux level, air gap and boundary condition were analyzed. The presence of a 6.4-mm air gap could improve thermal protective performance of the fabrics, however, the garment openings would decrease this positive effects. More severe thermal aging found for spaced test configuration indicated the importance of balancing the service life and thermal protective performance of the clothing. The findings of this study implied that the characteristics of fabric type, air gap, boundary condition, and their effects on fabric thermal aging should be considered during clothing ventilation designs, to balance the thermal protection and comfort of the protective gear.
The aim of the work was to investigate the effects of acacetin on endothelial dysfunction and aortic fibrosis in insulin-resistant SHR rats and explore its mechanism. Seven-week-old male spontaneously hypertensive rats (SHR) were selected to establish a rat model of hypertension with insulin resistance induced by 10% fructose. The nuclear factor kappa B p65 (NF-κB p65) and Collagen I were observed by Immunohistochemistry. Immunofluorescence was used to observe estrogen receptor-alpha (ERα), estrogen receptor-beta (ERβ), and G protein-coupled receptor 30 (GPR30). Western blotting was used to detect interleukin (IL-1β), Arginase 2 (ARG2), Nostrin, endothelial nitric oxide synthase (eNOS), TGF-β, Smad3, ERK pathway proteins such as p-c-Raf, p-MEK1/2, p-ERK, ERK, p-P90RSK and p-MSK1. We found that acacetin did have an improvement on endothelial dysfunction and fibrosis. Meanwhile, it was also found to have a significant effect on the level of estrogen in this model by accident. Then, the experiment of uterine weight gain in mice confirmed that acacetin had a certain estrogen-like effect in vivo and played its role through the estrogen receptors pathway. In vitro experience HUVEC cells were stimulated with 30 mM/L glucose and 100 mM/L NaCl for 24 h to establish the endothelial cell injury model. HUVEC cells were treated with 1 μM/L estrogen receptors antagonist (ICI 182780) for 30 min before administration. Cell experiments showed that acacetin could reduce the apoptosis of HUVEC cells, the levels of inflammatory cytokines and the expression of TGF-β, Collagen I and Smad3 in endothelial cell injury model. After treatment with ICI 182780, the improvement of acacetin was significantly reversed. The results showed that acacetin relieved endothelial dysfunction and reduced the aortic fibrosis in insulin-resistant SHR rats by reducing the release of inflammatory factors and improving vasodilatory function through estrogen signaling pathway.
Colon adenocarcinoma (COAD) is one of the most common gastrointestinal malignant tumors and is characterized by a high mortality rate. Here, we integrated whole-exome and RNA sequencing data from The Cancer Genome Atlas and investigated the mutational spectra of COAD-overexpressed genes to define clinically relevant diagnostic/prognostic signatures and to unmask functional relationships with both tumor-infiltrating immune cells and regulatory miRNAs. We identified 24 recurrently mutated genes (frequency > 5%) encoding putative COAD-specific neoantigens. Five of them (NEB, DNAH2, ABCA12, CENPF and CELSR1) had not been previously reported as COAD biomarkers. Through machine learning-based feature selection, four early-stage-related (COL11A1, TG, SOX9, and DNAH2) and four late-stage-related (COL11A1, SOX9, TG and BRCA2) candidate neoantigen-encoding genes were selected as diagnostic signatures. They respectively showed 100% and 97% accuracy in predicting early- and late-stage patients, and an 8-gene signature had excellent prognostic performance predicting disease-free survival (DFS) in COAD patients. We also found significant correlations between the 24 candidate neoantigen genes and the abundance and/or activation status of 22 tumor-infiltrating immune cell types and 56 regulatory miRNAs. Our novel neoantigen-based signatures may improve diagnostic and prognostic accuracy and help design targeted immunotherapies for COAD treatment.
In most eukaryotes, the meiotic chromosomal bouquet (comprising clustered chromosome ends) provides an ordered chromosome arrangement that facilitates pairing and recombination between homologous chromosomes. In the protist Tetrahymena thermophila, the meiotic prophase nucleus stretches enormously, and chromosomes assume a bouquet-like arrangement in which telomeres and centromeres are attached to opposite poles of the nucleus. We have identified and characterized three meiosis-specific genes [meiotic nuclear elongation 1-3 (MELG1-3)] that control nuclear elongation, and centromere and telomere clustering. The Melg proteins interact with cytoskeletal and telomere-associated proteins, and probably repurpose them for reorganizing the meiotic prophase nucleus. A lack of sequence similarity between the Tetrahymena proteins responsible for telomere clustering and bouquet proteins of other organisms suggests that the Tetrahymena bouquet is analogous, rather than homologous, to the conserved eukaryotic bouquet. We also report that centromere clustering is more important than telomere clustering for homologous pairing. Therefore, we speculate that centromere clustering may have been the primordial mechanism for chromosome pairing in early eukaryotes.
Influenza A virus is a single-stranded RNA virus that can cause great mortality and economic loss worldwide. Circular RNAs (circRNAs) are non-coding RNAs that have been shown to have important functions in the regulation of biological processes. However, their functions during the influenza A virus infection process remain unclear. Herein, RNA sequencing technology was used to identify circRNAs expressed in mouse lungs during infection with H7N9/PB2-627 K/701D (H7N9/Wild-type) virus and PB2 mutant viruses (H7N9/PB2-627E/701D and H7N9/PB2-627E/701 N). We identified 7126 circRNAs at different genomic locations during H7N9 influenza virus and its mutant virus infections, of which 186 were differentially expressed. Enrichment analysis revealed that the differentially expressed circRNAs were associated with the viral infection process. Our study shows that circRNA expression profiles were altered following H7N9 influenza A virus infection and the differentially expressed circRNAs may have an important immune-regulating function during viral infection.
Diabetes is a chronic metabolic disease characterized by insulin resistance (IR). SHP2 has previously been identified as a potential target to reduce IR in diabetes. Here, we examined the effects of SHP2 on glucose consumption (GC), IR level and the expression of insulin receptor substrate (IRS), AKT and extracellular signal-regulated kinase (ERK)1/2 proteins in a cellular and animal model of diabetes. IR was induced in hepatocellular carcinoma (HCC) cells, and SHP2 was up-regulated or down-regulated in cells. Diabetic rats were treated with SHP2 inhibitor. GC of cells, and the weight, total cholesterol, triglycerides, fasting blood glucose, fasting insulin, homeostasis model assessment-IR index and insulin sensitivity (ISI) of the rats were analyzed. The levels of SHP2 and the activation of IRS-2, AKT and ERK1/2 in cells and rats were measured by quantitative real-time PCR (qRT-PCR) or western blot. GC was reduced, but expression of SHP2 was enhanced in IR HCC cells. Phosphorylation of IRS-2 and AKT in IR HCC cells and diabetic rats was decreased, whereas phosphorylation of ERK1/2 was enhanced. In both the cell and animal models, SHP2 knockdown enhanced GC, ameliorated IR, activated IRS-2 and AKT, and inhibited ERK1/2 phosphorylation, in contrast with the effects of SHP2 overexpression. SHP2 knockdown may enhance GC and ameliorate IR through phosphorylation of IRS-2 via regulating AKT and ERK1/2 in liver.
MYB protooncogene-like 2 (MYBL2) is a transcription factor that is upregulated and significantly associated with various human cancer types. However, the potential role of MYBL2 in clear cell renal cell carcinoma (ccRCC) is yet to be elucidated. Therefore, the expression and biological functions of MYBL2 in ccRCC were assessed in the current study using The Cancer Genome Atlas (TCGA). A Wilcoxon signed-rank test was performed to compare MYBL2 expression between ccRCC and normal tissues. Moreover, the association between MYBL2 expression and various clinicopathological factors was estimated using both the Wilcoxon signed-rank test and logistic regression. The differences in prognosis between patients with high- and low-MYBL2 expression were analyzed via the Kaplan-Meier method and Cox regression analysis. Finally, gene set enrichment analysis (GSEA) was performed to investigate the biofunctions of MYBL2 in ccRCC. It was revealed that MYBL2 was upregulated in ccRCC, and that the MYBL2 high-expression phenotype was significantly associated with sex, a high histological grade, an advanced clinical stage, tumor stage, lymph node metastasis, distant metastasis and poor overall survival (OS). It was also revealed, via the Cox regression analysis, that the upregulation of MYBL2 expression was able to independently predict a poor prognosis in patients with ccRCC. GSEA indicated that the intestinal immune network for IgA production, primary immunodeficiency, the janus kinase (JAK)-signal transducer and activator of transcription (STAT) signaling pathway, the cytosolic DNA-sensing pathway, the p53 signaling pathway and the chemokine signaling pathway were all enriched in the high-MYBL2 expression datasets. In conclusion, the present findings indicate that MYBL2 may be used as an independent prognostic factor in patients with ccRCC.
Many Gram-negative bacterial pathogens utilize the type III secretion system (T3SS) to inject virulence factors, named effectors, into host cells. These T3SS effectors manipulate host cellular signaling pathways to facilitate bacterial pathogenesis. Death receptor signaling plays an important role in eukaryotic cell death pathways. NleB from enteropathogenic Escherichia coli (EPEC) and SseK1/3 from Salmonella enterica serovar Typhimurium (S. Typhimurium) are T3SS effectors. They are defined as a family of arginine GlcNAc transferase to modify a conserved arginine residue in the death domain (DD) of the death receptor TNFR and their corresponding adaptors to hijack death receptor signaling. Here we identified that these enzymes, NleB, SseK1, and SseK3 could catalyze auto-GlcNAcylation. Residues, including Arg13/53/159/293 in NleB, Arg30/158/339 in SseK1, and Arg153/184/305/335 in SseK3 were identified as the auto-GlcNAcylation sites by mass spectrometry. Mutation of the auto-modification sites of NleB, SseK1, and SseK3 abolished or attenuated the capability of enzyme activity toward their death domain targets during infection. Loss of this ability led to the increased susceptibility of the cells to TNF- or TRAIL-induced cell death during bacterial infection. Overall, our study reveals that the auto-GlcNAcylation of NleB, SseK1, and SseK3 is crucial for their biological activity during infection.
Serotonin or 5-hydroxytryptamine (5-HT) is an important neurotransmitter that is found in mammalian taste buds and can regulate the output of intragemmal signaling networks onto afferent nerve fibers. However, it is unclear how 5-HT is produced, synthesized locally inside taste buds or absorbed from outside sources. In this study, we attempt to address this question by delineating the process of possible 5-HT biosynthesis within taste buds. First, we verified that the rate-limiting enzyme tryptophan hydroxylase (TPH2) responsible for converting L-tryptophan into the intermediate 5-hydroxy-L-tryptophan (5-HTP) is expressed in a subset of type II taste bud cells (TBCs) whereas the enzyme aromatic L-aromatic amino acid decarboxylase (AADC) capable of converting 5-HTP into 5-HT is found in type III TBCs. And abolishment of TPH2 did not affect the production of intragemmal 5-HT or alter TBCs; the mutant mice did not show any changes in behavioral responses to all five primary taste qualities: sweet, umami, bitter, salty, and sour. Then we identified that 5-HTP as well as AADC are abundant in type III TBCs; and application of an AADC inhibitor significantly blocked the production of 5-HT in taste buds. In contrast, administration of an inhibitor on serotonin-reuptake transporters had minimal impact on the 5-HT amount in taste buds, indicating that exogenous 5-HT is not a major source for the intragemmal transmitter. Taken together, our data indicate that intragemmal serotonin is not biosynthesized de novo from tryptophan; instead, it is produced by AADC-mediated conversion of 5-HTP absorbed from the plasma and/or nerve fibers into 5-HT. Thus, our results suggest that the overall bodily 5-HTP level in the plasma and nervous system can regulate taste buds' physiological function, and provide an important molecular mechanism connecting these peripheral taste organs with the circulatory and nervous systems.
To preserve genome integrity, eukaryotic cells use small RNA-directed mechanisms to repress transposable elements (TEs). Paradoxically, in order to silence TEs, precursors of the small RNAs must be transcribed from TEs. However, it is still poorly understood how these precursors are transcribed from TEs under silenced conditions. In the otherwise transcriptionally silent germline micronucleus (MIC) of Tetrahymena, a burst of non-coding RNA (ncRNA) transcription occurs during meiosis. The transcripts are processed into small RNAs that serve to identify TE-related sequences for elimination. The Mediator complex (Med) has an evolutionarily conserved role for transcription by bridging gene-specific transcription factors and RNA polymerase II. Here, we report that three Med-associated factors, Emit1, Emit2, and Rib1, are required for the biogenesis of small ncRNAs. Med localizes to the MIC only during meiosis, and both Med localization and MIC ncRNA transcription require Emit1 and Emit2. In the MIC, Med occupies TE-rich pericentromeric and telomeric regions in a Rib1-dependent manner. Rib1 is dispensable for ncRNA transcription but is required for the accumulation of double-stranded ncRNAs. Nuclear and sub-nuclear localization of the three Med-associated proteins is interdependent. Hence, Emit1 and Emit2 act coordinately to import Med into the MIC, and Rib1 recruits Med to specific chromosomal locations to quantitatively or qualitatively promote the biogenesis of functional ncRNA. Our results underscore that the transcription machinery can be regulated by a set of specialized Med-associated proteins to temporally transcribe TE-related sequences from a silent genome for small RNA biogenesis and genome defense.
Hypertension is closely related to myocardial injury. Long-term hypertension can cause myocardial injury. Therefore, it is very important to find drugs to treat myocardial injury caused by hypertension. The aim of present study is to investigate the effects and mechanisms of geniposide on myocardial injuries in spontaneously hypertensive rats (SHR) and H9c2 cells induced by NaCl solution.
Welcome to the FDI Lab - SciCrunch.org Resources search. From here you can search through a compilation of resources used by FDI Lab - SciCrunch.org and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that FDI Lab - SciCrunch.org has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on FDI Lab - SciCrunch.org then you can log in from here to get additional features in FDI Lab - SciCrunch.org such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into FDI Lab - SciCrunch.org you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter your papers by.
From here we'll present any options for the literature, such as exporting your current results.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Year:
Count: