This service exclusively searches for literature that cites resources. Please be aware that the total number of searchable documents is limited to those containing RRIDs and does not include all open-access literature.
Introduction. With Chinese health care reform increasingly emphasizing the importance of primary care, the need for a tool to evaluate primary care performance and service delivery is clear. This study presents a methodology for a rapid assessment of primary care organizations and service delivery in China. Methods. The study translated and adapted the Primary Care Assessment Tool-Adult Edition (PCAT-AE) into a Chinese version to measure core dimensions of primary care, namely, first contact, continuity, comprehensiveness, and coordination. A cross-sectional survey was conducted to assess the validity and reliability of the Chinese Rapid Primary Care Assessment Tool (CR-PCAT). Eight community health centers in Guangdong province have been selected to participate in the survey. Results. A total of 1465 effective samples were included for data analysis. Eight items were eliminated following principal component analysis and reliability testing. The principal component analysis extracted five multiple-item scales (first contact utilization, first contact accessibility, ongoing care, comprehensiveness, and coordination). The tests of scaling assumptions were basically met. Conclusion. The standard psychometric evaluation indicates that the scales have achieved relatively good reliability and validity. The CR-PCAT provides a rapid and reliable measure of four core dimensions of primary care, which could be applied in various scenarios.
Prostate cancer (PCa) is the most commonly diagnosed malignancy and the second leading cause of cancer related death in men. The early diagnosis and treatment of PCa are still challenging due to the lack of efficient tumor targeting agents in traditional managements. Prostate specific membrane antigen (PSMA) is highly expressed in PCa, while only has limited expression in other organs, providing an ideal target for the diagnosis and therapy of PCa. The antibody library technique has opened the avenue for the discovery of novel antibodies to be used in the diagnosis and therapy of cancer. In this paper, by screening a large yeast display naive human single chain antibody fragment (scFv) library, we obtained a high affinity scFv targeting PSMA, called gy1. The gy1 scFv was expressed in E.coli and purified via a C terminal 6His tag. The binding affinity of gy1 was shown to be at the nanomolar level and gy1 can specifically bind with PSMA positive cancer cells, and binding triggers its rapid internalization through the endosome-lysosome pathway. The specific targeting of gy1 to PSMA positive tumor tissues was also evaluated in vivo. We showed that the IRDye800CW labeled gy1 can efficiently target and specifically distribute in PSMA positive tumor tissues after being injected into xenograft nude mice. This study indicated that the novel antibody gy1 could be used as a great tool for the development of PSMA targeted imaging and therapy agents for PCa.
Activation of cannabinoid receptor 2 (CB2R) ameliorates inflammation, but the underlying mechanism remains unclear. In the present study, we examined whether activation of CB2R could suppress the nucleotide-binding domain and leucine-rich repeat protein 3 (NLRP3) inflammasome. In peritoneal macrophages isolated from C57BL/6 mice, LPS/DSS challenge for 24 h increased the expression of the components of NLRP3 inflammasome NLRP3, Casp-1 p20/Casp-1 p45 ratio, proIL-1β and IL-1β and also enhanced autophagy (LC3-II/LC3-I ratio, Beclin-1 and SQSTM1). Pretreatment of peritoneal macrophages with HU 308, a selective CB2R agonist, attenuated LPS/DSS-induced NLRP3 inflammasome activation, but further enhanced autophagy. In comparison with wild-type (WT) control, peritoneal macrophages from CB2R knockout (KO) mice had more robust NLRP3 inflammasome activation and attenuated autophagy upon LPS/DSS challenge. Knockdown autophagy-related gene 5 (Atg5) with a siRNA in peritoneal macrophages attenuated the inhibitory effects of HU 308 on LPS/DSS-induced NLRP3 inflammasome activation in vitro. In vivo, HU308 treatment attenuated DSS-induced colitis mice associated with reduced colon inflammation and inhibited NLRP3 inflammasome activation in wild-type mice. In CB2R KO mice, DSS-induced inflammation and NLRP3 inflammasome activation were more pronounced than those in WT control. Finally, we demonstrated that AMPK-mTOR-P70S6K signaling pathway was involved in this CB2R-mediated process. We conclude that activation of CB2R ameliorates DSS-induced colitis through enhancing autophagy that may inhibit NLRP3 inflammasome activation in macrophages.
Hepatocellular carcinoma (HCC) is one of the most common kinds of malignancies and is closely correlated with hepatitis B virus (HBV) infection. Recent evidence has proved that long non-coding RNAs (lncRNAs) are implicated in development and progression of cancer. However, the contributions of lncRNAs to HBV-related HCC remain largely unknown. Here, we comprehensively investigated lncRNA expression profiles in HBV-related HCC by annotating and analyzing microarray datasets. By analyzing 42 HCC tissue samples with different etiology (HBV-related, alcohol-related, and primary HCC) and 15 normal liver tissues, we identified 182 lncRNAs that were specifically differentially expressed in HBV-related HCC, namely HBV-related HCC specific lncRNAs(HH-lncRNAs). Using an online function annotation tool, we found these HH-lncRNAs were associated many oncogenes and immunity related biological processes. 6 candidate HH-lncRNAs were selected and further validated by quantitative real-time PCR analysis in a cohort of HCC tissue samples. Function of a candidate HH-lncRNAs, BAIAP2-AS1, was further predicted by co-expression network and gene set enrichment analysis. These findings provide insights into HH-lncRNAs and offer resource for further search of biomarkers and therapeutic targets of HBV-related HCC.
Breast cancer brain metastases (BCBMs) are common in patients with metastatic breast cancer and indicate a poor prognosis. These tumors are especially resistant to currently available treatments due to multiple factors. However, the combination of chimeric antigen receptor (CAR)-modified immune cells and oncolytic herpes simplex virus (oHSV) has not yet been explored in this context. In this study, NK-92 cells and primary NK cells were engineered to express the second generation of EGFR-CAR. The efficacies of anti-BCBMs of EGFR-CAR NK cells, oHSV-1, and their combination were tested in vitro and in a breast cancer intracranial mouse model. In vitro, compared with mock-transduced NK-92 cells or primary NK cells, EGFR-CAR-engineered NK-92 cells and primary NK cells displayed enhanced cytotoxicity and IFN-γ production when co-cultured with breast cancer cell lines MDA-MB-231, MDA-MB-468, and MCF-7. oHSV-1 alone was also capable of lysing and destroying these cells. However, a higher cytolytic effect of EGFR-CAR NK-92 cells was observed when combined with oHSV-1 compared to the monotherapies. In the mice intracranially pre-inoculated with EGFR-expressing MDA-MB-231 cells, intratumoral administration of either EGFR-CAR-transduced NK-92 cells or oHSV-1 mitigated tumor growth. Notably, the combination of EGFR-CAR NK-92 cells with oHSV-1 resulted in more efficient killing of MDA-MB-231 tumor cells and significantly longer survival of tumor-bearing mice when compared to monotherapies. These results demonstrate that regional administration of EGFR-CAR NK-92 cells combined with oHSV-1 therapy is a potentially promising strategy to treat BCBMs.
Mesial temporal lobe epilepsy with hippocampal sclerosis (mTLE-HS) presents different clinical presentations from that with other lesions (OL). It is significant to investigate the neural mechanism underlying the different clinical presentations using neuroimaging study.Thirty mTLE patients with mTLE-HS, 30 mTLE patients with other lesions (mTLE-OL), and 30 age- and sex-matched healthy controls were involved. Amplitude of low-frequency fluctuation (ALFF) analysis-based resting-state functional magnetic resonance imaging (fMRI) and voxel-based morphometry (VBM) based morphometric MRI were employed to describing functional and structural imaging alterations in mTLE. Imaging parameters of ALFF and gray matter volume (GMV) were compared among groups and correlated with clinical variables and cognitive scores.For parameter of ALFF, both patient groups of mTLE-HS and mTLE-OL showed decrease in the frontal cortices relative to the healthy controls; mTLE-HS showed more decrease in the prefrontal and brain default regions relative to mTLE-OL. For GMV, both patient groups showed decrease in the frontal cortex, thalamus, and cerebellum; mTLE-HS showed more GMV decrease relative to the mTLE-OL, also mainly in the prefrontal and brain default regions. In both patient groups, the prefrontal regions showed negative correlation between GMV and epilepsy duration.This work revealed distinct alteration patterns of functional and structural brain organizations in mTLEs with different forms. MTLE-HS, despite with smaller lesion size of the pathological focus, presented more severe functional and structural damages in the extratemporal regions than mTLE-OL. The findings provided imaging evidence to support the proposal that mTLE-HS is a special epilepsy syndrome.
The metabolic hormone leptin has been implicated in the pathogenesis of various malignancies and may contribute to the high rate of cancer in obese individuals. We reported that leptin and its receptor are expressed by melanoma tumors and cell lines, and that leptin stimulates proliferation of cultured melanoma cells. Here, we tested the hypothesis that leptin contributes to early melanoma progression by assessing its association with sentinel node positivity in cutaneous melanoma patients. The study enrolled 72 patients who were scheduled to undergo lymphatic mapping and sentinel node biopsy. Fasting blood was obtained before surgery, and serum leptin levels were measured by enzyme-linked immunosorbent assay (ELISA) with a "raw" (assay value) and an "adjusted" value (raw value divided by body mass index). Leptin levels and other clinicopathologic parameters were compared between sentinel node positive and negative groups. Logistic regression models were used to predict sentinel node status using leptin and other relevant clinical parameters. The raw and adjusted leptin levels were significantly higher in the 15 patients with positive sentinel nodes. These findings could not be attributed to differences in body mass indices. Univariate models revealed raw leptin, adjusted leptin, Breslow thickness, and mitotic rate as significant predictors of sentinel node status. Leptin levels and Breslow thickness remained significant in multivariate models. Survival and follow-up analysis revealed more aggressive disease in diabetic patients. Elevated serum leptin levels predict sentinel node metastasis in melanoma. Validation of this finding in larger cohorts should enable better stratification of early stage melanoma patients.
We performed genome-wide identifications and comparative genomic analyses of the predicted aspartic proteases (APs) from eight parasitic flatworms, focusing on their evolution, potentials as drug targets and expression patterns. The results revealed that: i) More members of family A01 were identified from the schistosomes than from the cestodes; some evidence implied gene loss events along the class Cestoda, which may be related to the different ways to ingest host nutrition; ii) members in family A22 were evolutionarily highly conserved among all the parasites; iii) one retroviral-like AP in family A28 shared a highly similar predicted 3D structure with the HIV protease, implying its potential to be inhibited by HIV inhibitor-like molecules; and iiii) retrotransposon-associated APs were extensively expanded among these parasites. These results implied that the evolutionary histories of some APs in these parasites might relate to adaptations to their parasitism and some APs might have potential serving as intervention targets.
Charcot-Marie-Tooth disease type 4B2 with early-onset glaucoma (CMT4B2, OMIM 604563) is a genetically-heterogeneous childhood-onset neuromuscular disorder. Here, we report the case of a 15-year-old male adolescent with lower extremity weakness, gait abnormalities, foot deformities and early-onset glaucoma. Since clinical diagnosis alone was insufficient for providing pathogenetic evidence to indicate that the condition belonged to a consanguineous family, we applied whole-exome sequencing to samples from the patient, his parents and his younger brother, assuming that the patient's condition is transmitted in an autosomal recessive pattern. A frame-shift mutation, c.4571delG (P.Gly1524Glufs∗42), was revealed in the CMT4B2-related gene SBF2 (also known as MTMR13, MIM 607697), and this mutation was found to be homozygous in the proband and heterozygous in his parents and younger brother. Together with the results of clinical diagnosis, this case was diagnosed as CMT4B2. Our finding further demonstrates the use of whole-exome sequencing in the diagnosis and treatment of rare diseases.
The purpose of this study was to determine the correlation between over-expression of the neuropilin 1 (NRP1) gene and growth, survival, and radio-sensitivity of non-small cell lung carcinoma (NSCLC) cells. 3-[4,5-dimethylthylthiazol-2-yl]-2,5 diphenyltetrazolium broide (MTT) and colony assays were then performed to determine the effect of NRP1 inhibition on the in vitro growth of NSCLC cells. The Annexin V-Fluorescein Isothiocyanate (FITC) apoptosis detection assay was performed to analyse the effect of NRP1 enhancement on apoptosis of NSCLC cells. Transwell invasion and migration assays were employed to examine the metastatic ability of A549 cells post X-ray irradiation. In addition, Western blot assays were carried out to detect the protein level of VEGFR2, PI3K and NF-κB. Finally, to examine the effect of shNRP1 on proliferation and radio-sensitivity in vivo, a subcutaneous tumour formation assay in nude mice was performed. Microvessel density in tumour tissues was assessed by immunohistochemistry. The stable transfected cell line (shNRP1-A549) showed a significant reduction in colony-forming ability and proliferation not only in vitro, but also in vivo. Moreover, shRNA-mediated NRP1 inhibition also significantly enhanced the radio-sensitivity of NSCLC cells both in vitro and in vivo. The over-expression of NRP1 was correlated with growth, survival and radio-resistance of NSCLC cells via the VEGF-PI3K- NF-κB pathway, and NRP1 may be a molecular therapeutic target for gene therapy or radio-sensitization of NSCLC.
Transposition of great arteries (TGA) is a common congenital heart disease. Left ventricle (LV) is rapidly regressing and pulmonary artery banding (PAB) is utilized to retrain the undeveloped LV. Hence, it offered a unique human disease model to investigate the process of LV hypertrophy under pressure overload. Eight late referred children with TGA were enrolled. The plasma was collected at the 30 min. before and 48 hrs after PAB, and 25 proteins were identified as having significant change in proteomic analysis. Transferrin (TF) and ceruloplasmin were then confirmed. After 48 hrs incubation with TF, the size of human induced pluripotent stem cell-derived cardiomyocytes increased by two times as large as control. Meanwhile, protein synthesis and the expression of natriuretic peptide precursor A and B were significantly enhanced. TF treatment also activated both extracellular signal-regulated kinase 1/2 and activated protein kinase singling pathways. Our data provided a link to molecular components and pathways that might be involved in LV retraining. TF severed as the carrier to delivery irons, and could directly stimulate cardiomyocytes hypertrophy. TF administration may hold therapeutic potential for the biological LV retraining.
Fibroblast growth factor 21 (FGF21) promotes insulin sensitivity but causes bone loss. It elevates bone resorption by an undefined non-osteoclast-autonomous mechanism. We have detected a pro-osteoclastogenic activity in the hepatic secretome that is increased by FGF21 and largely attributed to insulin-like growth factor binding protein 1 (IGFBP1). Ex vivo osteoclast differentiation and in vivo bone resorption are both enhanced by recombinant IGFBP1 but suppressed by an IGFBP1-blocking antibody. Anti-IGFBP1 treatment attenuates ovariectomy-induced osteoporosis and abolishes FGF21-induced bone loss while maintaining its insulin-sensitizing metabolic benefit. Mechanistically, IGFBP1 functions via its RGD domain to bind to its receptor integrin β1 on osteoclast precursors, thereby potentiating RANKL-stimulated Erk-phosphorylation and NFATc1 activation. Consequently, osteoclastic integrin β1 deletion confers resistance to the resorption-enhancing effects of both IGFBP1 and FGF21. Therefore, the hepatokine IGFBP1 is a critical liver-bone hormonal relay that promotes osteoclastogenesis and bone resorption as well as an essential mediator of FGF21-induced bone loss.
The fibroblast growth factor (FGF) receptor pathway is activated in many tumors. FGFR2 has been identified as a breast cancer susceptibility gene. Common variation in other FGF receptors might also affect breast cancer risk. We carried out a case-control study to investigate associations of variants in FGFR3 and FGFR4 with breast cancer in women from Heilongjiang Province.
Treatment options are limited in well differentiated (WD) and dedifferentiated (DD) retroperitoneal liposarcoma. We sought to study the intratumoral adaptive immune response and explore the potential feasibility of immunotherapy in this disease. Tumor-infiltrating lymphocytes (TILs) were isolated from fresh surgical specimens and analyzed by flow cytometry for surface marker expression. Previously reported immune cell aggregates known as tertiary lymphoid structures (TLS) were further characterized by immunohistochemistry. In all fresh tumors, TILs were found. The majority of TILs were CD4 T cells; however cytotoxic CD8 T cells were also seen (average: 20% of CD3 T cells). Among CD8 T cells, 65% expressed the immune checkpoint molecule PD-1. Intratumoral TLS may be sites of antigen presentation as DC-LAMP positive, mature dendritic cells were found juxtaposed next to CD4 T cells. Clinicopathologic correlation, however, demonstrated that presence of TLS was associated with worse recurrence-free survival in WD disease and worse overall survival in DD disease. Our data suggest that an adaptive immune response is present in WD/DD retroperitoneal liposarcoma but may be hindered by TLS, among other possible microenvironmental factors; further investigation is needed. Immunotherapy, including immune checkpoint blockade, should be evaluated as a treatment option in this disease.
Genetic and transcriptional profiling, as well as surface marker identification of single circulating tumor cells (CTCs) have been demonstrated. However, quantitatively profiling of functional proteins at single CTC resolution has not yet been achieved, owing to the limited purity of the isolated CTC populations and a lack of single-cell proteomic approaches to handle and analyze rare CTCs. Here, we develop an integrated microfluidic system specifically designed for streamlining isolation, purification and single-cell secretomic profiling of CTCs from whole blood. Key to this platform is the use of photocleavable ssDNA-encoded antibody conjugates to enable a highly purified CTC population with <75 'contaminated' blood cells. An enhanced poly-L-lysine barcode pattern is created on the single-cell barcode chip for efficient capture rare CTC cells in microchambers for subsequent secreted protein profiling. This system was extensively evaluated and optimized with EpCAM-positive HCT116 cells seeded into whole blood. Patient blood samples were employed to assess the utility of the system for isolation, purification and single-cell secretion profiling of CTCs. The CTCs present in patient blood samples exhibit highly heterogeneous secretion profile of IL-8 and VEGF. The numbers of secreting CTCs are found not in accordance with CTC enumeration based on immunostaining in the parallel experiments.
Variants in cell cycle regulation genes, CDKAL1 and CDKN2A/2B, have been suggested to be associated with type 2 diabetes, and also play a role in insulin procession in non-diabetic European individuals. Rs7754580 in CDKAL1 and rs7020996 in CDKN2A/2B were found to be associated with gestational diabetes in Chinese individuals. In order to understand the metabolism mechanism of greatly upregulated maternal insulin signaling during pregnancy and the pathogenesis of gestational diabetes, we investigated the impact of rs7754580 and rs7020996 on gestational insulin regulation and procession.
Therapies based on urease inhibition are now seriously considered as the first line of treatment for infections caused by Helicobacter pylori. However, the present inhibitors are ineffective or unstable in highly acidic gastric juice. Here, we report a series of benzylanilines as effective inhibitors of H. pylori urease. Out of the obtained twenty-one compounds, N-(3,4-dihydroxybenzyl)-4-nitroaniline (4) was evaluated in detail and shows promising features for development as anti-H. pylori agent. Excellent potency against urease in both cell-free extract and intact cell was observed at low concentrations of 4 (IC50=0.62 ± 0.04 and 1.92 ± 0.09 μM), which showed over 29- and 54-fold increase in potency with respect to the positive control AHA. The SAR analysis revealed that protection of 3,4-dihydroxy group of 4 as methoxy or changes of 4-NO2 will result in a moderate to dramatic decrease in potency.
Oxidative stress plays a vital role in the development of cerebral ischemic/reperfusion (I/R). Targeting oxidative stress is proposed to be an effective strategy to treat cerebral I/R injury. Gentiana macrophylla Pall is reported to have a potential protective effect against stroke. Swertiamarin (Swe), an active secoiridoid glycoside compound isolated from Gentiana macrophylla Pall, has been reported to possess antioxidative potential. This study is to explore whether Swe could prevent brain from I/R injury, and the related mechanisms of oxidative stress are also elucidated using mice middle cerebral artery occlusion (MCAO) model and primary hippocampal neurons oxygen-glucose deprivation/reperfusion (OGD/R) model. Swe (25, 100, or 400 mg/kg) was pretreated intraperitoneally for 7 days until establishment of the MCAO model, while hippocampal neurons were maintained in Swe (0.1, 1, or 10 μM) in the entire process of reoxygenation. The results indicated that Swe pretreatment markedly decreased infarct volume, apoptotic neurons, and oxidative damage and promoted neurologic recovery in vivo. It also decreased reactive oxygen species (ROS) and increased cell viability in vitro. Western blot analyses and immunofluorescence staining demonstrated that Swe pretreatment promoted Nrf2 nuclear translocation from Keap1-Nrf2 complex and enhanced the expressions of NAD(P)H: quinone oxidoreductase-1 (NQO1) and heme oxygenase-1 (HO-1) both in vivo and in vitro, while the expressions could be reversed by a Nrf2 inhibitor. The binding mode of Keap1 with Swe was also proposed by covalent molecular docking. Collectively, Swe could be considered as a promising protective agent against cerebral I/R injury through suppressing oxidative stress by activation of the Nrf2 protective pathway.
Owing to the multifactorial nature of the pathogenesis of diabetic peripheral neuropathy (DPN), conventional drug therapies have not been effective. The application of stem cells transplantation may be useful for the treatment of DPN. This study was designed to assess the safety and therapeutic effects of autologous bone marrow mononuclear cells (BMMNCs) transplantation on the treatment of refractory DPN.
The expression of secreted protein acidic and rich in cysteine (SPARC) has been recently identified to be associated with the pathology of diabetic retinopathy. Therefore, the present study aimed to evaluate the regulatory role of SPARC in human retinal capillary endothelial cells (HRCECs), following exposure to a high glucose environment in vitro. The cell viability, migration, angiogenesis, permeability and SPARC expression levels of HRCECs were measured following treatment with different concentrations of glucose (25, 50 or 100 mM). Lentiviral vectors (LV185-pL_shRNA_mKate2-SPARC-543; target sequence, GGATGAGGACAACAACCTTCT) that inhibit the expression of SPARC were constructed, and HRCECs were evaluated when infected by viruses carrying the lentiviral vectors. Cell viability was examined using the Cell Counting Kit-8 assay. The expression of SPARC in HRCECs increased as the concentration of glucose in the culture medium increased. Relatively high concentrations of glucose significantly inhibited cell proliferation (P<0.05), migration (P<0.05), angiogenesis (P<0.01), and the expression of ZO, occludin, claudin and JAM1 in tight junctions (P<0.01), gap junctions (Cx37 and Cx43; P<0.01) and adherens junctions (VE-cadherin, CTNNA1 and CTNNB1; P<0.05). However, when SPARC was downregulated by lentiviral vectors, the inhibitions induced by high concentrations of glucose were partially reversed. To conclude, the inhibitory effects on cell viability, migration, angiogenesis and cellular adhesion of HRCECs induced by high concentrations of glucose were reversed once the expression of SPARC was inhibited. These findings suggest that SPARC may serve an important role in pathogenesis of diabetic retinopathy.
Welcome to the FDI Lab - SciCrunch.org Resources search. From here you can search through a compilation of resources used by FDI Lab - SciCrunch.org and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that FDI Lab - SciCrunch.org has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on FDI Lab - SciCrunch.org then you can log in from here to get additional features in FDI Lab - SciCrunch.org such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into FDI Lab - SciCrunch.org you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter your papers by.
From here we'll present any options for the literature, such as exporting your current results.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Year:
Count: