Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
SD-Tertem3Mcwi Resource Report The record is no longer available at this source. |
RRID:RGD_13207522 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Tert gene of Crl:SD rat embryos. The resulting mutation is a 17-bp deletion of exon1 in Tert gene. MCW Gene Editing Rat Resource Center This is a legacy resource. | (null) | (null) | (null) | 13207522 | mutant | RGD, Rat Genome Database Strain List RGD | RGD | Not Available | 2024-01-31 07:40:17 | 0 | |||
|
F344-Fmr1em1Rrrc Resource Report The record is no longer available at this source. |
RRID:RGD_11537344 | Rattus norvegicus | The CRISPR/Cas9 genome editing system was used to generate this mutant rat strain. It inserted 55-79 copies of human premutation CGG repeats of the FMR1 gene into rat Fmr1. The recipient zygotes were from inbred strain F344 at RRRC. Rat Resource and Research Center This is a legacy resource. | (null) | (null) | (null) | 11537344 | mutant | RGD, Rat Genome Database Strain List RGD | RGD | Not Available | 2024-01-31 07:40:17 | 0 | |||
|
SS-Avpr2em3Mcwi Resource Report The record is no longer available at this source. |
RRID:RGD_13208586 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in Exon 2 of the Avpr2 gene. MCW Gene Editing Rat Resource Center This is a legacy resource. | (null) | (null) | (null) | 13208586 | mutant | RGD, Rat Genome Database Strain List RGD | RGD | Not Available | 2024-01-31 07:40:18 | 0 | |||
|
SS-Avpr2em2Mcwi Resource Report The record is no longer available at this source. |
RRID:RGD_13208585 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in Exon 2 of the Avpr2 gene. MCW Gene Editing Rat Resource Center This is a legacy resource. | (null) | (null) | (null) | 13208585 | mutant | RGD, Rat Genome Database Strain List RGD | RGD | Not Available | 2024-01-31 07:40:18 | 0 | |||
|
SD-Prl7b1tm1(cre)Soar Resource Report Resource Website |
001013 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce Cre recombinase downstream of the Prl7b1 start site. Rat Resource and Research Center | 001013 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-11-21) | RGD_401900746 | 2025-08-16 03:25:59 | 0 | |||||
|
LE-Synpoem2Kmh Resource Report Resource Website |
001025 | Rattus norvegicus | Exons 2 and 3 were deleted to eliminate all known Synaptopodin isoforms in the outbred Long Evans (Charles River 006). It is similar to RRRC strain #964 (LE-Synpoem1Kmh) (RGD:155782907), has a different mutation location upstream of exon 2. This strain is deposited at Rat Resource and Research Center | 001025 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Cryopreserved Sperm (as of 2025-05-13) | RGD_616335891 | 2025-08-16 03:26:02 | 0 | |||||
|
LE-Pink1em1Davis Resource Report Resource Website |
001007 | Rattus norvegicus | The CRISPR-Cas9 system was used to delete the coding region (exons 1-8) of the Pink1 gene in NTac:SD embryos. The rat is deposited at Rat Resource and Research Center (RRRC). Rat Resource and Research Center | 001007 | mutant | Rat Resource and Research Center (RRRC) | RRRC | Cryorecovery (as of 2025-01-27) | RGD_401827145 | 2025-08-16 03:26:02 | 0 | |||||
|
SD-Krt71m1Yuyi Resource Report Resource Website |
RRID:RGD_10002787 | Rattus norvegicus | Several rats curled arose spontaneously in a closed colony of SD rats maintained at Laboratory Animal Center of Zhengzhou University. a 3 bp deletion at position 420-422 of Krt71 which results in the deletion of aspartate was identified. | 10002787 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 10002787 | 2026-09-12 01:24:59 | 0 | |||||
|
SD-Fahem3Mcwi Resource Report Resource Website |
RRID:RGD_10002791 | Rattus norvegicus | This strain was produced by injecting TALENs targeting the sequence CTCAGTGTTCCTACTCTgcccctcccagaggttcaATGCTTTGTGTTCAATGTCG into Crl:SD rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 3. Availability contact: [email protected] | 10002791 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-11-03) | 10002791 | 2026-09-12 01:24:59 | 0 | |||||
|
SS-Mmp9em4Mcwi Resource Report Resource Website |
RRID:RGD_10054414 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Mmp9 gene of SS/JrHsdMcwi rat embryos. Contact MCW rat distribution at [email protected] | 10054414 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 10054414 | 2026-09-12 01:25:00 | 0 | |||||
|
BN-Lx Resource Report Resource Website |
RRID:RGD_61113 | Rattus norvegicus | These were derived by introgressing mutant Lx gene of the polydactylous rat onto the BN background. | 61113 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 61113 | 2026-09-12 01:25:00 | 0 | |||||
|
WI-Foxn1em1Nips Resource Report Resource Website 1+ mentions |
RRID:RGD_10053598 | Rattus norvegicus | Foxn1 mutation was induced by injecting pX330 expressing Cas9 and sgRNA targeting the sequence GACTGGAGGGCGAACCCCAA into Crlj:WI rat embryos. The resulting mutation is a 44-bp frameshift deletion in exon 1 (del 54-97). Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN | 10053598 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 10053598 | 2026-09-12 01:24:59 | 1 | |||||
|
SD-Fusem1Ionsz Resource Report Resource Website |
RRID:RGD_10047085 | Rattus norvegicus | CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+Oligo was injected into zygote of SD rat. The mutation changed the 521th amino acid Arg (R) into Cys (C). Institute of Neuroscience, Chinese Academy of Sciences | 10047085 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 10047085 | 2026-09-12 01:24:59 | 0 | |||||
|
LEW-Chrna5em1Mcwi Resource Report Resource Website |
RRID:RGD_10054386 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Chrna5 gene of LEW/NCrl rat embryos. The resulting mutation is a 1-bp insertion in the Chrna5 gene. Contact MCW rat distribution at [email protected] | 10054386 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2018-11-26) | 10054386 | 2026-09-12 01:25:00 | 0 | |||||
|
LEW-Chrna4em3Mcwi Resource Report Resource Website |
RRID:RGD_10054383 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Chrna4 gene of LEW/NCrl rat embryos. The resulting mutation is a 16-bp deletion in the Chrna4 gene. Contact MCW rat distribution at [email protected] | 10054383 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2018-11-26) | 10054383 | 2026-09-12 01:25:00 | 0 | |||||
|
DA-Glaem2Mcwi Resource Report Resource Website |
RRID:RGD_10054398 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Gla gene of DA/OlaHsd rat embryos. The resulting mutation is a 47-bp deletion in the Gla gene. Contact MCW rat distribution at [email protected] | 10054398 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm (as of 2018-10-22) | 10054398 | 2026-09-12 01:25:00 | 0 | |||||
|
FHH-Chr 3BN-Helz2em3Mcwi Resource Report Resource Website |
RRID:RGD_10054401 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Helz2 gene of FHH-Chr 3BN/Mcwi rat embryos.The resulting mutation is a 11-bp deletion in the Helz2 gene. Contact MCW rat distribution at [email protected] | 10054401 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm (as of 2018-10-22) | 10054401 | 2026-09-12 01:25:00 | 0 | |||||
|
LEW-Chrna3em9Mcwi Resource Report Resource Website |
RRID:RGD_10054376 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Chrna3 gene of LEW/NCrl rat embryos. The resulting mutation is a 17-bp deletion in the Chrna3 gene. Contact MCW rat distribution at [email protected] | 10054376 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2018-11-26) | 10054376 | 2026-09-12 01:25:00 | 0 | |||||
|
SS-Arhgef11em5Mcwi Resource Report Resource Website |
RRID:RGD_10054296 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Arhgef11 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in the Arhgef11 gene. Contact MCW rat distribution at [email protected] | 10054296 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2018-10-22) | 10054296 | 2026-09-12 01:25:01 | 0 | |||||
|
SS-Sirt3em4Mcwi Resource Report Resource Website |
RRID:RGD_10054453 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in the Sirt3 gene. Contact MCW rat distribution at [email protected] | 10054453 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 10054453 | 2026-09-12 01:25:01 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
