Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00033905
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
Source References: PMID:8514128
Synonyms: dpy-5(e61) unc-13(e51) I; gaDp1 (I;f).
Alternate IDs: WB-STRAIN:SD63, CGC_SD63
Notes: Animals with the duplication are WT. Animals which have lost the duplication are DpyUnc. Maintain by picking WT.
Proper citation: RRID:WB-STRAIN:WBStrain00033905 Copy
http://www.wormbase.org/db/get?name=WBStrain00034126
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61) unc-54(e190) I.
Alternate IDs: WB-STRAIN:SP24, CGC_SP24
Notes: DpyUnc.
Proper citation: RRID:WB-STRAIN:WBStrain00034126 Copy
http://www.wormbase.org/db/get?name=WBStrain00037915
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00017816(hrpk-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00017816(hrpk-1)
Availability: available
Source References: EMPTY
Synonyms: hrpk-1(gk5045[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC18 [dpy-5(tmIs1236)] I.
Alternate IDs: WB-STRAIN:VC4098, CGC_VC4098
Notes: Homozygous lethal deletion balanced by tmC18. Deletion of 1976 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAAATGATGATCAAAGTGGGAGCCGCTA ; Right flanking sequence: GGTGGATCTGTCTAGGTTCTGGTGTTCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous sterile deletion balanced by tmC18. Heterozygotes are wild-type with pharyngeal GFP+RFP+, and segregate GFP+RFP+ heterozygotes, GFP+ gk5045 homozygotes (most commonly sterile, but occasional animals will lay eggs that hatch, and a population of homozygotes can be maintained), and tmC18 homozygotes (Dpy-5 with myo-2 mCherry). Pick fertile wild-type GFP+RFP+ to maintain. Deletion of 1976 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAAATGATGATCAAAGTGGGAGCCGCTA ; Right flanking sequence: GGTGGATCTGTCTAGGTTCTGGTGTTCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037915 Copy
http://www.wormbase.org/db/get?name=WBStrain00040443
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61) unc-13(e51) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:WM149, CGC_WM149
Notes: Heterozygotes are WT with pharyngeal GFP signal, and segragate WT GFP+, arrested hT2 aneuploids, and non-GFP Dpy Unc homozygotes. Homozygous hT2[bli-4 let-? qIs48] are inviable.
Proper citation: RRID:WB-STRAIN:WBStrain00040443 Copy
http://www.wormbase.org/db/get?name=WBStrain00040929
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006797(unc-63)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006797(unc-63)
Availability: available
Source References: EMPTY
Synonyms: unc-63(x18) dpy-5(e61) I.
Alternate IDs: WB-STRAIN:ZZ1004, CGC_ZZ1004
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00040929 Copy
http://www.wormbase.org/db/get?name=WBStrain00040931
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006774(unc-38)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006774(unc-38)
Availability: available
Source References: EMPTY
Synonyms: unc-38(x20) dpy-5(e61) I.
Alternate IDs: WB-STRAIN:ZZ1015, CGC_ZZ1015
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00040931 Copy
http://www.wormbase.org/db/get?name=WBStrain00034439
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003221(mes-3)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003221(mes-3)
Availability: available
Source References: PMID:1783292
Synonyms: mes-3(bn35) dpy-5(e61) I; sDp2 (I;f).
Alternate IDs: WB-STRAIN:SS262, CGC_SS262
Notes: Animals with the Duplication have a WT phenotype. Animals which have lost the Duplication are Dpy and give sterile Dpy progeny. Strict maternal effect sterile. Sterile worms have a dramatic reduction in number of germs cells (10-100 fold less than WT). See also WBPaper00002343.
Proper citation: RRID:WB-STRAIN:WBStrain00034439 Copy
http://www.wormbase.org/db/get?name=WBStrain00007264
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001067(dpy-5)|WBGene00003397(mom-5)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001067(dpy-5), WBGene00003397(mom-5)
Availability: available
Source References: PMID:9288749
Synonyms: dpy-5(e61) mom-5(or57)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III.
Alternate IDs: WB-STRAIN:EU311, CGC_EU311
Notes: Heterozygotes are WT and segregate WT, Dpys and dead eggs. Dpys give only embryonic lethals which lack endoderm and make excess mesoderm. or57 is a recessive maternal-effect lethal.|"mut-2 background"
Proper citation: RRID:WB-STRAIN:WBStrain00007264 Copy
http://www.wormbase.org/db/get?name=WBStrain00007331
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001067(dpy-5)|WBGene00003396(mom-4)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001067(dpy-5), WBGene00003396(mom-4)
Availability: available
Source References: PMID:10444600
Synonyms: dpy-5(e61) mom-4(or49)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III.
Alternate IDs: WB-STRAIN:EU927, CGC_EU927
Notes: Heterozygotes are WT and segregate WT, Dpys which give only dead eggs and dead eggs.
Proper citation: RRID:WB-STRAIN:WBStrain00007331 Copy
http://www.wormbase.org/db/get?name=WBStrain00007470
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: available
Source References: WBPaper00000289(PMID:EMPTY)WBPaper00016102(PMID:EMPTY)
Synonyms: dpy-5(f1) I.
Alternate IDs: WB-STRAIN:FF1, CGC_FF1
Notes: Dpy. Semi-sterile. Bergerac background. [NOTE: Presumably sterile at 25C because of temperature-sensitive zyg-12(ct350) in the background (Malone et al., Cell 2003).]|"Made_by: Michel Dion"|"Mutagen:spontaneous"
Proper citation: RRID:WB-STRAIN:WBStrain00007470 Copy
http://www.wormbase.org/db/get?name=WBStrain00007580
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006753(unc-14)|WBGene00016944(uri-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006753(unc-14), WBGene00016944(uri-1)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61) uri-1(tm939)/dpy-5(e61) unc-14(e57) I.
Alternate IDs: WB-STRAIN:FX11501, CGC_FX11501
Notes: Heterozygotes are Dpy. Segregate Dpy Unc. tm939 homozygotes are emb, leth, pvl, rup, larval arrested or sterile.|"This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00007580 Copy
http://www.wormbase.org/db/get?name=WBStrain00007627
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006753(unc-14)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006753(unc-14)
Availability: available
Source References: PMID:39652010
Synonyms: tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I.
Alternate IDs: WB-STRAIN:FX30179, CGC_FX30179
Notes: Break points: In(F53G12.8 T02E1.7 In(gsp-3 sre-23)) I. Covered region (Mb) 8.1 (0.1..8.3) Balancer marked with myo-2p::Venus. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.|"Made_by: Mitani Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00007627 Copy
http://www.wormbase.org/db/get?name=WBStrain00007624
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: available
Source References: EMPTY
Synonyms: tmC18 [dpy-5(tmIs1236)] I.
Alternate IDs: WB-STRAIN:FX30168, CGC_FX30168
Notes: Break points: In(B0207.10 dnj-27 In(gsp-3 sre-23)) I. Covered region (Mb) 7.2 (4.7..11.9) Balancer marked with myo-2p::mCherry. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.|"Made_by: Mitani Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00007624 Copy
http://www.wormbase.org/db/get?name=WBStrain00007623
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: available
Source References: PMID:37651423
Synonyms: tmC18 [dpy-5(tmIs1200)] I.
Alternate IDs: WB-STRAIN:FX30167, CGC_FX30167
Notes: Break points: In(B0207.10 dnj-27 In(gsp-3 sre-23)) I. Covered region (Mb) 7.2 (4.7..11.9) Balancer marked with myo-2p::Venus. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.|"Made_by: Mitani Lab"|"Supplementary_genotype tmC18 [dpy-5(tmIs1200)] I"
Proper citation: RRID:WB-STRAIN:WBStrain00007623 Copy
http://www.wormbase.org/db/get?name=WBStrain00007985
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00001354(evl-16)|WBGene00006751(unc-11)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001354(evl-16), WBGene00006751(unc-11)
Availability: available
Source References: PMID:8500652
Synonyms: evl-16(ar93)/unc-11(e47) dpy-5(e61) I.
Alternate IDs: WB-STRAIN:GS304, CGC_GS304
Notes: Heterozygotes are WT and segregate WT, DpyUncs and Steriles which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
Proper citation: RRID:WB-STRAIN:WBStrain00007985 Copy
http://www.wormbase.org/db/get?name=WBStrain00008021
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003001(lin-12)|WBGene00006768(unc-32)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003001(lin-12), WBGene00006768(unc-32)
Availability: available
Source References: PMID:8293978
Synonyms: dpy-5(e61) sel(ar40) I; unc-32(e189) lin-12(n676n930) III.
Alternate IDs: WB-STRAIN:GS883, CGC_GS883
Notes: DpyUnc. ar40 is a semi-dominant suppressor. At 25C ar40 suppresses the Egl phenotype of ne676n930. At 15C a high percentage of hermaphrodites have a 0 AC-Egl phenotype. ar40 suppresses proximal mitosis. ar40 does not suppress vulval lineage defects. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
Proper citation: RRID:WB-STRAIN:WBStrain00008021 Copy
http://www.wormbase.org/db/get?name=WBStrain00005021
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001067(dpy-5)|WBGene00006772(unc-36)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001067(dpy-5), WBGene00006772(unc-36)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61)/hT2 [umnIs73] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III.
Alternate IDs: WB-STRAIN:CGC92, CGC_CGC92
Notes: umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT mKate2+ and segregate WT mKate2+, DpyUnc, lethal mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional mKate+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
Proper citation: RRID:WB-STRAIN:WBStrain00005021 Copy
http://www.wormbase.org/db/get?name=WBStrain00005015
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001067(dpy-5)|WBGene00006772(unc-36)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001067(dpy-5), WBGene00006772(unc-36)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61)/hT2 I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661) umnIs67] III.
Alternate IDs: WB-STRAIN:CGC86, CGC_CGC86
Notes: umnIs67 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] III. Heterozygotes are WT GFP+ and segregate WT GFP+, DpyUnc, lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
Proper citation: RRID:WB-STRAIN:WBStrain00005015 Copy
http://www.wormbase.org/db/get?name=WBStrain00005501
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006791(unc-57)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006791(unc-57)
Availability: available
Source References: PMID:8462849
Synonyms: unc-57(ad592) dpy-5(e61) I.
Alternate IDs: WB-STRAIN:DA678, CGC_DA678
Notes: DpyUnc. ad592 is Eat. Dpy is semi-dominant.
Proper citation: RRID:WB-STRAIN:WBStrain00005501 Copy
http://www.wormbase.org/db/get?name=WBStrain00005538
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006765(unc-29)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006765(unc-29)
Availability: available
Source References: PMID:8349107
Synonyms: hDf10 dpy-5(e61) unc-29(e403) I; sDp2 (I;f).
Alternate IDs: WB-STRAIN:DA1046, CGC_DA1046
Notes: Animals carrying sDp2 are Unc and segregate Unc and dead eggs.
Proper citation: RRID:WB-STRAIN:WBStrain00005538 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within SPARC SAWG that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
