Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00033334
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005030(sra-4)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005030(sra-4), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: sra-4(ve504[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Alternate IDs: WB-STRAIN:RG3004, CGC_RG3004
Notes: Homozygous viable. Deletion of 1294 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ggtgtgaaagattttaaataaacaccctcg ; Right flanking sequence: CAAGGACATtctttaaaagtaaaaagaacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1294 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ggtgtgaaagattttaaataaacaccctcg ; Right flanking sequence: CAAGGACATtctttaaaagtaaaaagaacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Emily Lorenz-Mueller"|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-4. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ggtgtgaaagattttaaataaacaccctcg Right flanking sequence: CAAGGACATtctttaaaagtaaaaagaacc"
Proper citation: RRID:WB-STRAIN:WBStrain00033334 Copy
http://www.wormbase.org/db/get?name=WBStrain00033335
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005057(sra-31)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005057(sra-31), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: sra-31(ve506[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Alternate IDs: WB-STRAIN:RG3006, CGC_RG3006
Notes: Homozygous viable. Deletion of 1008 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gttttattttttaaatacCGTCATAAAAGC ; Right flanking sequence: CCAGGAATTTCCATtttagctgatatagat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1008 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: gttttattttttaaatacCGTCATAAAAGC ; Right flanking sequence: CCAGGAATTTCCATtttagctgatatagat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-31. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites."
Proper citation: RRID:WB-STRAIN:WBStrain00033335 Copy
http://www.wormbase.org/db/get?name=WBStrain00033491
Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Source References: WBPaper00016376(PMID:EMPTY)WBPaper00016444(PMID:EMPTY)
Synonyms: unc-54(st132) I.
Alternate IDs: WB-STRAIN:RW132, CGC_RW132
Notes: Dominant suppressor of unc-22(s12). See WBG 9(1):22 and WBG 9(2):18 and C. elegans II page 427. [Jan 2007: Taylor Allen suggests that st132 may have a temperature sensitive phenotype.]
Proper citation: RRID:WB-STRAIN:WBStrain00033491 Copy
http://www.wormbase.org/db/get?name=WBStrain00033495
Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)|WBGene00006821(unc-90)
Genomic Alteration: WBGene00006789(unc-54), WBGene00006821(unc-90)
Availability: available
Source References: EMPTY
Synonyms: unc-54(e1301) I; unc-90(e1463) X.
Alternate IDs: WB-STRAIN:RW1029, CGC_RW1029
Notes: Lethal. Cold sensitive. Class 3 allele. Poor viability.
Proper citation: RRID:WB-STRAIN:WBStrain00033495 Copy
http://www.wormbase.org/db/get?name=WBStrain00033531
Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: unc-54(s95) I.
Alternate IDs: WB-STRAIN:RW5008, CGC_RW5008
Notes: Paralyzed Rigid Unc. Muscle birefrigence is normal. Muscle is normal in EM.
Proper citation: RRID:WB-STRAIN:WBStrain00033531 Copy
http://www.wormbase.org/db/get?name=WBStrain00033532
Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: unc-54(s291) I.
Alternate IDs: WB-STRAIN:RW5019, CGC_RW5019
Notes: Unc.
Proper citation: RRID:WB-STRAIN:WBStrain00033532 Copy
http://www.wormbase.org/db/get?name=WBStrain00033504
Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)|WBGene00006819(unc-87)
Genomic Alteration: WBGene00006789(unc-54), WBGene00006819(unc-87)
Availability: available
Source References: EMPTY
Synonyms: unc-87(e843) unc-54(s95) I.
Alternate IDs: WB-STRAIN:RW1523, CGC_RW1523
Notes: Made_by: Gusan Goetinck|"Unc. unc-87 affects muscle thin filaments. unc-54(s95) is a missense myosin heavy chain mutation that assembles properly but does not function well in contraction."
Proper citation: RRID:WB-STRAIN:WBStrain00033504 Copy
http://www.wormbase.org/db/get?name=WBStrain00033514
Source Database: WormBase (WB)
Affected Genes: WBGene00002325(let-50)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00002325(let-50), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: unc-54(e190)/let-50(st33) I.
Alternate IDs: WB-STRAIN:RW3024, CGC_RW3024
Notes: Heterozygotes are WT and segregate WT, Unc, and Lethals. Lethal early larval. Balanced well. Maintain by picking WT.
Proper citation: RRID:WB-STRAIN:WBStrain00033514 Copy
http://www.wormbase.org/db/get?name=WBStrain00034126
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61) unc-54(e190) I.
Alternate IDs: WB-STRAIN:SP24, CGC_SP24
Notes: DpyUnc.
Proper citation: RRID:WB-STRAIN:WBStrain00034126 Copy
http://www.wormbase.org/db/get?name=WBStrain00034953
Source Database: WormBase (WB)
Affected Genes: WBGene00004884(smg-6)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00004884(smg-6), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: unc-54(r293) I; smg-6(r1217) III.
Alternate IDs: WB-STRAIN:TR2264, CGC_TR2264
Notes: mut-2 background|"mut-5 background"|"P-Vul. WT movement."
Proper citation: RRID:WB-STRAIN:WBStrain00034953 Copy
http://www.wormbase.org/db/get?name=WBStrain00034951
Source Database: WormBase (WB)
Affected Genes: WBGene00004882(smg-4)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00004882(smg-4), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: unc-54(r293) I; smg-4(r1169) V.
Alternate IDs: WB-STRAIN:TR2192, CGC_TR2192
Notes: P-vul. WT movement.
Proper citation: RRID:WB-STRAIN:WBStrain00034951 Copy
http://www.wormbase.org/db/get?name=WBStrain00034942
Source Database: WormBase (WB)
Affected Genes: WBGene00004883(smg-5)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00004883(smg-5), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: smg-5(r860) unc-54(r293) I.
Alternate IDs: WB-STRAIN:TR1324, CGC_TR1324
Notes: P-Vul.
Proper citation: RRID:WB-STRAIN:WBStrain00034942 Copy
http://www.wormbase.org/db/get?name=WBStrain00035171
Source Database: WormBase (WB)
Affected Genes: WBGene00006598(tor-2)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00006598(tor-2), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: Q19::GFP
Alternate IDs: WB-STRAIN:UA3
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00035171 Copy
http://www.wormbase.org/db/get?name=WBStrain00035177
Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:UA38
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00035177 Copy
http://www.wormbase.org/db/get?name=WBStrain00036087
Source Database: WormBase (WB)
Affected Genes: WBGene00001334(ero-1)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001334(ero-1), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: ero-1(ok1287)/unc-54(e190) I.
Alternate IDs: WB-STRAIN:VC814, CGC_VC814
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y105E8B.8. Homozygous lethal deletion chromosome balanced by unc-54(e190). Heterozygotes are WT, and segregate WT, paralyzed Unc (unc-54 homozygotes), and ok1287 homozygotes (probable early larval arrest). Strain is reasonably well balanced, but requires a bit of care. Presence of coily Uncs among progeny indicates recombination may have occurred; the nature of these animals is not known, but they are usually WT by PCR. Pick WT and check for correct segregation of progeny to maintain. Segregation ratio of WT:Unc should be 2:1 and not 3:1."
Proper citation: RRID:WB-STRAIN:WBStrain00036087 Copy
http://www.wormbase.org/db/get?name=WBStrain00023575
Source Database: WormBase (WB)
Affected Genes: WBGene00003921(par-6)|WBGene00006789(unc-54)|WBGene00006829(unc-101)
Genomic Alteration: WBGene00003921(par-6), WBGene00006789(unc-54), WBGene00006829(unc-101)
Availability: available
Source References: PMID:8898226
Synonyms: par-6(zu222) unc-101(m1)/hIn1 [unc-54(h1040)] I.
Alternate IDs: WB-STRAIN:KK818, CGC_KK818
Notes: Heterozygotes are WT and segregate WT, paralyzed Unc, and Coilers which give only dead eggs (slightly leaky, but survivors are agametic). zu222 is a strict maternal effect embryonic lethal. Partitioning defect similar to that of par-3; fails to localize PAR-3 protein.|"mut-6 background"
Proper citation: RRID:WB-STRAIN:WBStrain00023575 Copy
http://www.wormbase.org/db/get?name=WBStrain00023969
Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Source References: WBPaper00013695(PMID:EMPTY)
Synonyms: hDf17/hIn1 [unc-54(h1040)] I.
Alternate IDs: WB-STRAIN:KR2838, CGC_KR2838
Notes: Wild-type phenotype. Segregates WT, Unc-54 (hIn1[unc-54] homozygotes), dead eggs (hDf17 homozygotes). Pick WT and check for correct segregation of progeny to maintain. See WBG 14: 29. This deletion was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. CGC received new stock 9/3/97.
Proper citation: RRID:WB-STRAIN:WBStrain00023969 Copy
http://www.wormbase.org/db/get?name=WBStrain00027091
Source Database: WormBase (WB)
Affected Genes: WBGene00000415(ced-1)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000415(ced-1), WBGene00006789(unc-54)
Availability: available
Source References: PMID:1936965
Synonyms: ced-1(e1735) unc-54(e1092) I.
Alternate IDs: WB-STRAIN:MT3778, CGC_MT3778
Notes: Unc. Abnormal cell death.
Proper citation: RRID:WB-STRAIN:WBStrain00027091 Copy
http://www.wormbase.org/db/get?name=WBStrain00027251
Source Database: WormBase (WB)
Affected Genes: WBGene00000253(bli-3)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000253(bli-3), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: bli-3(e767) unc-54(e1092) I.
Alternate IDs: WB-STRAIN:MT6183, CGC_MT6183
Notes: Mapping strain.
Proper citation: RRID:WB-STRAIN:WBStrain00027251 Copy
http://www.wormbase.org/db/get?name=WBStrain00030552
Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Source References: PMID:8244003
Synonyms: unc-54(e190) I; ccIs126.
Alternate IDs: WB-STRAIN:PD126, CGC_PD126
Notes: ccIs126 [myo-2p::lacZ + unc-54(+)]. lacZ expression in pharyngeal and body wall muscles. Superficially wild-type, but gives some paralyzed animals.
Proper citation: RRID:WB-STRAIN:WBStrain00030552 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within SPARC SAWG that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
