Organisms   Select Another Resource Report Type

http://www.wormbase.org/db/get?name=WBStrain00037915

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00017816(hrpk-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00017816(hrpk-1)
Availability: available
Source References: EMPTY
Synonyms: hrpk-1(gk5045[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC18 [dpy-5(tmIs1236)] I.
Alternate IDs: WB-STRAIN:VC4098, CGC_VC4098
Notes: Homozygous lethal deletion balanced by tmC18. Deletion of 1976 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAAATGATGATCAAAGTGGGAGCCGCTA ; Right flanking sequence: GGTGGATCTGTCTAGGTTCTGGTGTTCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous sterile deletion balanced by tmC18. Heterozygotes are wild-type with pharyngeal GFP+RFP+, and segregate GFP+RFP+ heterozygotes, GFP+ gk5045 homozygotes (most commonly sterile, but occasional animals will lay eggs that hatch, and a population of homozygotes can be maintained), and tmC18 homozygotes (Dpy-5 with myo-2 mCherry). Pick fertile wild-type GFP+RFP+ to maintain. Deletion of 1976 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAAATGATGATCAAAGTGGGAGCCGCTA ; Right flanking sequence: GGTGGATCTGTCTAGGTTCTGGTGTTCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00037915 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00033905

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
Source References: PMID:8514128
Synonyms: dpy-5(e61) unc-13(e51) I; gaDp1 (I;f).
Alternate IDs: WB-STRAIN:SD63, CGC_SD63
Notes: Animals with the duplication are WT. Animals which have lost the duplication are DpyUnc. Maintain by picking WT.

Proper citation: RRID:WB-STRAIN:WBStrain00033905 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00034126

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61) unc-54(e190) I.
Alternate IDs: WB-STRAIN:SP24, CGC_SP24
Notes: DpyUnc.

Proper citation: RRID:WB-STRAIN:WBStrain00034126 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00034439

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003221(mes-3)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003221(mes-3)
Availability: available
Source References: PMID:1783292
Synonyms: mes-3(bn35) dpy-5(e61) I; sDp2 (I;f).
Alternate IDs: WB-STRAIN:SS262, CGC_SS262
Notes: Animals with the Duplication have a WT phenotype. Animals which have lost the Duplication are Dpy and give sterile Dpy progeny. Strict maternal effect sterile. Sterile worms have a dramatic reduction in number of germs cells (10-100 fold less than WT). See also WBPaper00002343.

Proper citation: RRID:WB-STRAIN:WBStrain00034439 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00026620

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003170(mec-6)|WBGene00006748(unc-8)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003170(mec-6), WBGene00006748(unc-8)
Availability: available
Source References: PMID:7539392
Synonyms: dpy-5(e61) mec-6(lb84) I; unc-8(n491) IV.
Alternate IDs: WB-STRAIN:MP84, CGC_MP84
Notes: Dpy.

Proper citation: RRID:WB-STRAIN:WBStrain00026620 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00026735

Source Database: WormBase (WB)
Affected Genes: WBGene00000252(bli-2)|WBGene00001067(dpy-5)|WBGene00006768(unc-32)
Genomic Alteration: WBGene00000252(bli-2), WBGene00001067(dpy-5), WBGene00006768(unc-32)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61) I; bli-2(e768) II; unc-32(e189) III.
Alternate IDs: WB-STRAIN:MT465, CGC_MT465
Notes: Made_by: Tsung/Horvitz|"Mapping strain. DpyUnc."

Proper citation: RRID:WB-STRAIN:WBStrain00026735 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00026847

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003056(lon-2)|WBGene00003156(mcm-4)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003056(lon-2), WBGene00003156(mcm-4)
Availability: available
Source References: PMID:7262539
Synonyms: mcm-4(e1466) dpy-5(e61)/szT1 [lon-2(e678)] I; +/szT1 X.
Alternate IDs: WB-STRAIN:MT1442, CGC_MT1442
Notes: Heterozygotes are WT and segregate WT, Dpy (these are thin, sterile and Unc after L1--there is no sexual maturation), and Lon males. Maintain by picking WT.

Proper citation: RRID:WB-STRAIN:WBStrain00026847 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00027045

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00004773(sem-4)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00004773(sem-4)
Availability: available
Source References: PMID:3200316
Synonyms: dpy-5(e61) sem-4(n1378) I.
Alternate IDs: WB-STRAIN:MT3213, CGC_MT3213
Notes: Dpy. Egl. Transformation of sex myoblasts into body wall muscle.

Proper citation: RRID:WB-STRAIN:WBStrain00027045 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00027088

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00004397(rol-6)|WBGene00006768(unc-32)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00004397(rol-6), WBGene00006768(unc-32)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61) I; rol-6(e187) II; unc-32(e189) III.
Alternate IDs: WB-STRAIN:MT3751, CGC_MT3751
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00027088 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00027279

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003186(mek-2)|WBGene00006320(sup-11)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003186(mek-2), WBGene00006320(sup-11)
Availability: available
Source References: PMID:7729691
Synonyms: mek-2(n2679)/sup-11(n403) dpy-5(e61) I.
Alternate IDs: WB-STRAIN:MT7026, CGC_MT7026
Notes: Heterozygotes are WT and segregate WT, steriles with a vulval defect, and scrawny Dpys. n2679 is a suppressor of let-60(n1046) Muv, and is recessive sterile with vulval defects. n267 is an intermediate strength allele. See also WBPaper00002150.

Proper citation: RRID:WB-STRAIN:WBStrain00027279 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00027269

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00002248(lam-3)|WBGene00006807(unc-75)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00002248(lam-3), WBGene00006807(unc-75)
Availability: available
Source References: EMPTY
Synonyms: lam-3(n2561)/dpy-5(e61) unc-75(e950) I.
Alternate IDs: WB-STRAIN:MT6550, CGC_MT6550
Notes: Heterozygotes are WT. Segregate Dpy Uncs. Segregate L1 lethal: starved, uncoordinated, defective pharyngeal basement membrane.

Proper citation: RRID:WB-STRAIN:WBStrain00027269 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00062741

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00005077(src-1)|WBGene00006753(unc-14)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00005077(src-1), WBGene00006753(unc-14)
Availability: unknown
Source References: EMPTY
Synonyms: src-1(lq185)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I; juIs76 II.
Notes: juIs76 [unc-25p::GFP + lin-15(+)] II. Precise deletion of src-1 generated by Cas9 genome editing. Balancer marked with myo-2p::Venus. Heterozygotes are wild-type with Venus+ pharynx, and will segregate wild-type with Venus+ pharynx (heterozygotes), sterile adults without Venus in pharynx (lq185 homozygotes), and Dpy with Venus+ pharynx (tmC20 homozygotes). GFP expression in GABAergic motor neurons. Reference: Mahadik S, et al. bioRxiv 2023.05.20.541322; doi: https:

Proper citation: RRID:WB-STRAIN:WBStrain00062741 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00054788

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00001595(gld-1)|WBGene00006751(unc-11)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001595(gld-1), WBGene00006751(unc-11)
Availability: unknown
Source References: EMPTY
Synonyms: gld-1(q343)/unc-11(e47) dpy-5(e61) I
Notes: Heterozygotes are WT and segregate WT, Dpy Uncs, and homozygous q343 (make small abnormal oocytes. Pick WT and check for correct segregation of progeny to maintain. Reference: Francis R, et al. Genetics. 1995 Feb; 139(2): 579606. doi: 10.1093/genetics/139.2.579 PMID: 7713419.

Proper citation: RRID:WB-STRAIN:WBStrain00054788 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00055739

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: unknown
Source References: EMPTY
Synonyms: dpy-5(e61) I; fjDf1 fjDf2 fjDf3 fjDf4 X.
Notes: This strain carries a dpy-5 mutation to facilitate genome modification in CeRep55 quadruple deletion background: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.|"This strain carries a dpy-5 mutation to facilitate genome modification in CeRep55 quadruple deletion background: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002."

Proper citation: RRID:WB-STRAIN:WBStrain00055739 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00022592

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001067(dpy-5)|WBGene00001077(dpy-18)|WBGene00003156(mcm-4)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001067(dpy-5), WBGene00001077(dpy-18), WBGene00003156(mcm-4)
Availability: available
Source References: EMPTY
Synonyms: mcm-4(e1466) dpy-5(e61)/hT2 I; dpy-18(e364) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:JK2810, CGC_JK2810
Notes: Heterozygotes are medium Dpy and glowing. Hets throw small, sterile DpyUncs and dead eggs. hT2[bli-4(e937) qIs48] is homozygous lethal. qIs48 is an insertion of ccEx9747 with markers myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embyro, and gut promoter F22B7.9 driving GFP in the intestine. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.|"Made_by: K. Siegfried"

Proper citation: RRID:WB-STRAIN:WBStrain00022592 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00022537

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00004958(spe-4)|WBGene00006751(unc-11)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00004958(spe-4), WBGene00006751(unc-11)
Availability: available
Source References: EMPTY
Synonyms: spe-4(q347)/unc-11(e47) dpy-5(e61) I.
Alternate IDs: WB-STRAIN:JK1075, CGC_JK1075
Notes: Heterozygotes are WT. Segregates Dpy Uncs, and females (primary spermatocyte death). Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"mut-2 background"

Proper citation: RRID:WB-STRAIN:WBStrain00022537 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00022569

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00001596(gld-2)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001596(gld-2), WBGene00006752(unc-13)
Availability: available
Source References: PMID:9550713
Synonyms: gld-2(q497)/dpy-5(e61) unc-13(e51) I.
Alternate IDs: WB-STRAIN:JK1743, CGC_JK1743
Notes: Heterozygotes are WT and segregate WT, DpyUncs and Steriles. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Proper citation: RRID:WB-STRAIN:WBStrain00022569 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00022558

Source Database: WormBase (WB)
Affected Genes: WBGene00000468(ces-1)|WBGene00001067(dpy-5)|WBGene00006807(unc-75)|WBGene00010327(srf-2)
Genomic Alteration: WBGene00000468(ces-1), WBGene00001067(dpy-5), WBGene00006807(unc-75), WBGene00010327(srf-2)
Availability: available
Source References: PMID:7713418
Synonyms: ces-1(n703) qDf7/dpy-5(e61) srf-2(yj262) unc-75(e950) I.
Alternate IDs: WB-STRAIN:JK1542, CGC_JK1542
Notes: Heterozygotes are Srf and grow slowly. Hets segregate Srf, DpyUncSrf and dead eggs. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. CGC rec'd new stock 10/99.|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00022558 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00022553

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00001595(gld-1)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001595(gld-1), WBGene00006752(unc-13)
Availability: available
Source References: PMID:7713419, PMID:32707947, PMID:36098634
Synonyms: gld-1(q485)/dpy-5(e61) unc-13(e51) I.
Alternate IDs: WB-STRAIN:JK1466, CGC_JK1466
Notes: Heterozygotes are WT and segregate WT, DpyUncs and steriles with a tumorous germline. Pick WT to maintain. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Proper citation: RRID:WB-STRAIN:WBStrain00022553 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00022582

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001067(dpy-5)|WBGene00004077(pop-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001067(dpy-5), WBGene00004077(pop-1)
Availability: available
Source References: EMPTY
Synonyms: pop-1(q645) dpy-5(e61) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:JK2689, CGC_JK2689
Notes: Heterozygotes are WT and glow, segregate non-glowing Dpy Steriles. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.|"Made_by: K. Siegfried"

Proper citation: RRID:WB-STRAIN:WBStrain00022582 Copy   

•   Source: Integrated Animals