Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search
Reset search
On page 41 showing 801 ~ 820 out of 1,575 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:WB-STRAIN:WBStrain00030722

http://www.wormbase.org/db/get?name=WBStrain00030722

Source Database: WormBase (WB)
Affected Genes: WBGene00000548(clr-1)|WBGene00003186(mek-2)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000548(clr-1), WBGene00003186(mek-2), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: mek-2(ku114) I; clr-1(e1745) II; ccIs55 V.
Alternate IDs: WB-STRAIN:PJ1124, CGC_PJ1124
Notes: ccIs55 [unc-54::lacZ + sup-7(st5)] V. Egl. Bags at high frequency. Semi-Clr.

Proper citation: RRID:WB-STRAIN:WBStrain00030722 Copy   

    • RRID:WB-STRAIN:WBStrain00030721

http://www.wormbase.org/db/get?name=WBStrain00030721

Source Database: WormBase (WB)
Affected Genes: WBGene00002299(let-23)|WBGene00006744(unc-4)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00002299(let-23), WBGene00006744(unc-4), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: unc-4(e120) let-23(sa62) II; ccIs55 V.
Alternate IDs: WB-STRAIN:PJ1121, CGC_PJ1121
Notes: ccIs55 [unc-54::lacZ + sup-7(st5)] V. Unc. Muv.

Proper citation: RRID:WB-STRAIN:WBStrain00030721 Copy   

    • RRID:WB-STRAIN:WBStrain00030720

http://www.wormbase.org/db/get?name=WBStrain00030720

Source Database: WormBase (WB)
Affected Genes: WBGene00002015(hsp-16.1)|WBGene00002016(hsp-16.2)|WBGene00002018(hsp-16.41)|WBGene00002019(hsp-16.48)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00002015(hsp-16.1), WBGene00002016(hsp-16.2), WBGene00002018(hsp-16.41), WBGene00002019(hsp-16.48), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: gaIs37 IV; ccIs55 V.
Alternate IDs: WB-STRAIN:PJ1115, CGC_PJ1115
Notes: gaIs37 [Ef1a::Dmek hs::mpk-1] IV. ccIs55 [unc-54::lacZ + sup-7(st5)] V. At 20C, 99% of the worms are WT. At 25C, close to 100% of the worms are Muv. Also, a heat-shock at the L2 stage can produce a 80-90% Muv phenotype.

Proper citation: RRID:WB-STRAIN:WBStrain00030720 Copy   

    • RRID:WB-STRAIN:WBStrain00030729

http://www.wormbase.org/db/get?name=WBStrain00030729

Source Database: WormBase (WB)
Affected Genes: WBGene00000548(clr-1)|WBGene00001185(egl-17)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000548(clr-1), WBGene00001185(egl-17), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: clr-1(e1745) II; ccIs55 V; egl-17(n1377) X.
Alternate IDs: WB-STRAIN:PJ1154, CGC_PJ1154
Notes: ccIs55 [unc-54::lacZ + sup-7(st5)] V. Egl - moderate to severe bloating. 30% make bags of worms. Clr.

Proper citation: RRID:WB-STRAIN:WBStrain00030729 Copy   

    • RRID:WB-STRAIN:WBStrain00030728

http://www.wormbase.org/db/get?name=WBStrain00030728

Source Database: WormBase (WB)
Affected Genes: WBGene00000548(clr-1)|WBGene00002881(let-756)|WBGene00006768(unc-32)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000548(clr-1), WBGene00002881(let-756), WBGene00006768(unc-32), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: clr-1(e1745) II; let-756(s2613) unc-32(e189) III; ccIs55 V.
Alternate IDs: WB-STRAIN:PJ1153, CGC_PJ1153
Notes: ccIs55 [unc-54::lacZ + sup-7(st5)] V. Homozygous viable and fertile, but slow-growing, transparent, and small (but not scrawny). Coiler Unc. clr-1 is temperature-sensitive.

Proper citation: RRID:WB-STRAIN:WBStrain00030728 Copy   

    • RRID:WB-STRAIN:WBStrain00030726

http://www.wormbase.org/db/get?name=WBStrain00030726

Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: ccIs55 V; njEx38.
Alternate IDs: WB-STRAIN:PJ1145, CGC_PJ1145
Notes: ccIs55 [unc-54::lacZ + sup-7(st5)] V. njEx38 [unc-54p::daf-2(+) + goa-1p::GFP + rol-6(su1006)]. Maintain by picking Rollers. Slight Egl.

Proper citation: RRID:WB-STRAIN:WBStrain00030726 Copy   

    • RRID:WB-STRAIN:WBStrain00030703

http://www.wormbase.org/db/get?name=WBStrain00030703

Source Database: WormBase (WB)
Affected Genes: WBGene00002335(let-60)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00002335(let-60), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: let-60(n2021) IV; ccIs55 V.
Alternate IDs: WB-STRAIN:PJ1065, CGC_PJ1065
Notes: ccIs55 [unc-54::lacZ + sup-7(st5)] V. Vul/Egl. ras loss-of-signal.

Proper citation: RRID:WB-STRAIN:WBStrain00030703 Copy   

    • RRID:WB-STRAIN:WBStrain00030709

http://www.wormbase.org/db/get?name=WBStrain00030709

Source Database: WormBase (WB)
Affected Genes: WBGene00000090(age-1)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000090(age-1), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: age-1(hx546) II; ccIs55 V.
Alternate IDs: WB-STRAIN:PJ1080, CGC_PJ1080
Notes: ccIs55 [unc-54::lacZ + sup-7(st5)] V.

Proper citation: RRID:WB-STRAIN:WBStrain00030709 Copy   

    • RRID:WB-STRAIN:WBStrain00030706

http://www.wormbase.org/db/get?name=WBStrain00030706

Source Database: WormBase (WB)
Affected Genes: WBGene00001515(gap-1)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001515(gap-1), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: ccIs55 V; gap-1(ga133) X.
Alternate IDs: WB-STRAIN:PJ1076, CGC_PJ1076
Notes: ccIs55 [unc-54::lacZ + sup-7(st5)] V.

Proper citation: RRID:WB-STRAIN:WBStrain00030706 Copy   

    • RRID:WB-STRAIN:WBStrain00030705

http://www.wormbase.org/db/get?name=WBStrain00030705

Source Database: WormBase (WB)
Affected Genes: WBGene00000548(clr-1)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000548(clr-1), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: clr-1(e1745) II; ccIs55 V.
Alternate IDs: WB-STRAIN:PJ1070, CGC_PJ1070
Notes: ccIs55 [unc-54::lacZ + sup-7(st5)] V. Clear. Grows very poorly at 25C.

Proper citation: RRID:WB-STRAIN:WBStrain00030705 Copy   

    • RRID:WB-STRAIN:WBStrain00030704

http://www.wormbase.org/db/get?name=WBStrain00030704

Source Database: WormBase (WB)
Affected Genes: WBGene00002335(let-60)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00002335(let-60), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: let-60(sy93) IV; ccIs55 V.
Alternate IDs: WB-STRAIN:PJ1069, CGC_PJ1069
Notes: ccIs55 [unc-54::lacZ + sup-7(st5)] V. Dominant Vul allele, however, worms appear to be Egl and have multiple pseudovulvae (due to sup-7??).

Proper citation: RRID:WB-STRAIN:WBStrain00030704 Copy   

    • RRID:WB-STRAIN:WBStrain00030733

http://www.wormbase.org/db/get?name=WBStrain00030733

Source Database: WormBase (WB)
Affected Genes: WBGene00003965(pdk-1)|WBGene00006741(unc-1)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003965(pdk-1), WBGene00006741(unc-1), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: ccIs55 V; unc-1(e719) pdk-1(sa680) X.
Alternate IDs: WB-STRAIN:PJ1162, CGC_PJ1162
Notes: ccIs55 [unc-54::lacZ + sup-7(st5)] V. Unc - recessive kinker. Daf-c at 25C. Egl, Clumpy, Lon, low brood size. Dauers do not recover when moved to 15C in the presence of food. Daf-c, Lon, Clumpy, and fertility defects can be rescued maternally.

Proper citation: RRID:WB-STRAIN:WBStrain00030733 Copy   

    • RRID:WB-STRAIN:WBStrain00030731

http://www.wormbase.org/db/get?name=WBStrain00030731

Source Database: WormBase (WB)
Affected Genes: WBGene00000090(age-1)|WBGene00005016(sqt-1)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000090(age-1), WBGene00005016(sqt-1), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: sqt-1(sc13) age-1(mg44) II; ccIs55 V; mgEx499.
Alternate IDs: WB-STRAIN:PJ1156, CGC_PJ1156
Notes: ccIs55 [unc-54::lacZ + sup-7(st5)] V. mgEx499 [unc-54p::age-1 + mec-7p::GFP]. Left-hand rollers. Long and thin. Maintain at 16C.

Proper citation: RRID:WB-STRAIN:WBStrain00030731 Copy   

    • RRID:WB-STRAIN:WBStrain00030730

http://www.wormbase.org/db/get?name=WBStrain00030730

Source Database: WormBase (WB)
Affected Genes: WBGene00001185(egl-17)|WBGene00002881(let-756)|WBGene00006768(unc-32)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001185(egl-17), WBGene00002881(let-756), WBGene00006768(unc-32), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: let-756(s2613) unc-32(e189) III; ccIs55 V; egl-17(n1377) X.
Alternate IDs: WB-STRAIN:PJ1155, CGC_PJ1155
Notes: ccIs55 [unc-54::lacZ + sup-7(st5)] V. Egg laying defective. Moderate to severe bloating. >50% make bags of worms.

Proper citation: RRID:WB-STRAIN:WBStrain00030730 Copy   

    • RRID:WB-STRAIN:WBStrain00037903

http://www.wormbase.org/db/get?name=WBStrain00037903

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: C06A6.4(gk5145[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV.
Alternate IDs: WB-STRAIN:VC4071, CGC_VC4071
Notes: Homozygous viable. Deletion of 2765 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAATGAAATTTTAGTTAACATTGGCCAGTT ; Right flanking sequence: CACGGAACCGTGTCACTCCAATATCTTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00037903 Copy   

    • RRID:WB-STRAIN:WBStrain00037904

http://www.wormbase.org/db/get?name=WBStrain00037904

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00012639(fezf-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00012639(fezf-1)
Availability: available
Source References: EMPTY
Synonyms: fezf-1(gk5147[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV.
Alternate IDs: WB-STRAIN:VC4073, CGC_VC4073
Notes: Homozygous viable. Deletion of 2724 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AACTAAAGGCAAATCTGGATATAAACCGCC ; Right flanking sequence: ATCGTATAACCTTGCATTCCACATGTTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00037904 Copy   

    • RRID:WB-STRAIN:WBStrain00037902

http://www.wormbase.org/db/get?name=WBStrain00037902

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00022025(cus-2)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00022025(cus-2)
Availability: available
Source References: EMPTY
Synonyms: cus-2(gk5141[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I.
Alternate IDs: WB-STRAIN:VC4067, CGC_VC4067
Notes: Homozygous viable. Deletion of 4196 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AGAATCTCAAAAAATCGATGAAATCCATGA ; Right flanking sequence: CGGCGTCGTATCGGTAACCTTTCCAACGAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00037902 Copy   

    • RRID:WB-STRAIN:WBStrain00037906

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00037906

Source Database: WormBase (WB)
Affected Genes: WBGene00002260(lbp-8)|WBGene00003515(myo-3)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00002260(lbp-8), WBGene00003515(myo-3), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: lbp-8(gk5151[loxP + myo-3p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V.
Alternate IDs: WB-STRAIN:VC4077, CGC_VC4077
Notes: Homozygous viable. Deletion of 438 bp with Calarco/Colaiacovo selection cassette conferring myo-3 GFP and G418 resistance inserted at break. Left flanking sequence: ATTAACAACTCAATTAATTCAGTCCTTCCT ; Right flanking sequence: CTGGGAGCGTCATTTGTCGTAGAGAGTTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00037906 Copy   

    • RRID:WB-STRAIN:WBStrain00037914

http://www.wormbase.org/db/get?name=WBStrain00037914

Source Database: WormBase (WB)
Affected Genes: WBGene00003515(myo-3)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003515(myo-3), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: eef-1A.2(gk5157[loxP + myo-3p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X.
Alternate IDs: WB-STRAIN:VC4096, CGC_VC4096
Notes: Homozygous viable. Deletion of 1624 bp with Calarco/Colaiacovo selection cassette conferring myo-3 GFP and G418 resistance inserted at break. Left flanking sequence: CTCTCAGCCTAAAACATATTTAAGCCTCCC ; Right flanking sequence: GATCATCCGGAAAGGTCACCAAGTCCGCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00037914 Copy   

    • RRID:WB-STRAIN:WBStrain00037918

http://www.wormbase.org/db/get?name=WBStrain00037918

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: AC8.1(gk5162[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X.
Alternate IDs: WB-STRAIN:VC4104, CGC_VC4104
Notes: Homozygous viable. Deletion of 7222 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTCCTAGAATCGACCGCTTTCAGTGTATT ; Right flanking sequence: TGGGCCCAGTTTTCGGACGGTGGTTTTGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00037918 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. SPARC Anatomical Working Group Resources

    Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within SPARC SAWG that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

The Stimulating Peripheral Activity to Relieve Conditions (SPARC) effort is the result of National Institutes of Health’s (NIH) drive to map out the neural circuitry responsible for visceral control in higher vertebrates. The SPARC Anatomy Working Group (SAWG) is responsible for the integrity of anatomical knowledge in SPARC

Recent News Entries

Contact Us

Maryann Martone, Ph.D.

Department of Neurosciences, School of Medicine

University of California, San Diego

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch