Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00004416
Source Database: WormBase (WB)
Affected Genes: WBGene00002459(let-203)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00002459(let-203), WBGene00006789(unc-54)
Availability: available
Source References: PMID:6589606
Synonyms: let-203(e1717) unc-54(e1092)/eDf24 I.
Alternate IDs: WB-STRAIN:CB2780, CGC_CB2780
Notes: Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
Proper citation: RRID:WB-STRAIN:WBStrain00004416 Copy
http://www.wormbase.org/db/get?name=WBStrain00004435
Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: unc-54(e1258) I; wdDp1 V.
Alternate IDs: WB-STRAIN:CB3035, CGC_CB3035
Notes: Suppressed Unc.
Proper citation: RRID:WB-STRAIN:WBStrain00004435 Copy
http://www.wormbase.org/db/get?name=WBStrain00004433
Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Source References: PMID:2575705
Synonyms: unc-54(e1258) I; eDf1 eDp21/+ V.
Alternate IDs: WB-STRAIN:CB3019, CGC_CB3019
Notes: Movement slow. Suppressed Unc. Revertant. Heterozygotes move slowly and segregate larval lethals (eDf1 eDp21 homozygotes), and paralyzed Uncs.
Proper citation: RRID:WB-STRAIN:WBStrain00004433 Copy
http://www.wormbase.org/db/get?name=WBStrain00004991
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: F36D4.4(umn4[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Alternate IDs: WB-STRAIN:CGC61, CGC_CGC61
Notes: Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of F36D4.4. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: atgacaatgtctcaagggtccatgtactcccctatatcttccaaacattc Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCTCAATTTATTTGTCATTATTG"
Proper citation: RRID:WB-STRAIN:WBStrain00004991 Copy
http://www.wormbase.org/db/get?name=WBStrain00004989
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00008737(gnrr-7)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00008737(gnrr-7)
Availability: available
Source References: EMPTY
Synonyms: gnrr-7(umn3[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X.
Alternate IDs: WB-STRAIN:CGC59, CGC_CGC59
Notes: Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of gnrr-7. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ATATTTATTTAATATATATTTTGTTCTGGTTTAAAGCCGCAAAGTCTTGG Right flanking sequence: AGGGTACCATCAAGCAATGGCATTCTGGTTGCCCTTAAGCATAACAATTG"
Proper citation: RRID:WB-STRAIN:WBStrain00004989 Copy
http://www.wormbase.org/db/get?name=WBStrain00004988
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: C54E10.3(umn2[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Alternate IDs: WB-STRAIN:CGC58, CGC_CGC58
Notes: Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of C54E10.3. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: tctccgcctaaaaaaatatatgtacccccgatgggattcgaacctgtggc Right flanking sequence: GGGTATGCAAAATGACCGCGTTTTCTGTGAATTCATCGTCATGCTTTATT"
Proper citation: RRID:WB-STRAIN:WBStrain00004988 Copy
http://www.wormbase.org/db/get?name=WBStrain00005002
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00021328(npr-23)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00021328(npr-23)
Availability: available
Source References: EMPTY
Synonyms: npr-23(umn5[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Alternate IDs: WB-STRAIN:CGC72, CGC_CGC72
Notes: Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of npr-23. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: cccctgcctctggctcccacaaggcgtcatctggagagaagaacgaagtg Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGCGTTGCTCGTATTGGTGCCGG"
Proper citation: RRID:WB-STRAIN:WBStrain00005002 Copy
http://www.wormbase.org/db/get?name=WBStrain00005081
Source Database: WormBase (WB)
Affected Genes: WBGene00003474(mtl-2)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003474(mtl-2), WBGene00006789(unc-54)
Availability: unknown
Source References: PMID:9751195
Synonyms: N2; dvEx121 [pCL12 (unc-54/b 1-42) + pCL26
Alternate IDs: WB-STRAIN:CL1121
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005081 Copy
http://www.wormbase.org/db/get?name=WBStrain00005094
Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Source References: PMID:7568134, PMID:9751195, PMID:32966472, PMID:34707479, PMID:36226991, PMID:36653384, PMID:37103980, PMID:37522064, PMID:37113386, PMID:37549461, PMID:38983916, PMID:38991033, PMID:39950089
Synonyms: dvIs2 [Punc-54::human A-beta 3-42; pRF4 (rol-6(su1006]
Alternate IDs: WB-STRAIN:CL2006, CGC_CL2006
Notes: dvIs2 [pCL12(unc-54/human Abeta peptide 1-42 minigene) + rol-6(su1006)]. Temperature-sensitive. Maintain at 15C. Adult onset paralysis and egg-laying deficiency when raised at 20C. A few animals will be paralyzed even at permissive temperatures. Received new stock from CL 8/2005.|"WBStrain provided so WBPaper00059477 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062076 paper added based on AFP_Strain data."|"[2020-08-03T18:23:09.013Z WBPerson324] Ressurect Strain: Paper: WBPaper00002289 Genotype: dvIs2 [Punc-54::human A-beta 3-42; pRF4 (rol-6(su1006]"
Proper citation: RRID:WB-STRAIN:WBStrain00005094 Copy
http://www.wormbase.org/db/get?name=WBStrain00005093
Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: unknown
Source References: PMID:7568134, PMID:9751195
Synonyms: dvIs2 [Punc-54::human A-beta 3-42; pRF4 (rol-6(su1006]
Alternate IDs: WB-STRAIN:CL2005
Notes: [2020-08-03T18:27:21.884Z WBPerson324] Ressurect Strain: WBPaper: WBPaper00002289 Genotype: dvIs2 [Punc-54::human A-beta 3-42; pRF4 (rol-6(su1006]
Proper citation: RRID:WB-STRAIN:WBStrain00005093 Copy
http://www.wormbase.org/db/get?name=WBStrain00005007
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: C04C3.6(umn8[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
Alternate IDs: WB-STRAIN:CGC78, CGC_CGC78
Notes: Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of C04C3.6. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ttgaaaatttgaaatttgaaaaaaatcaactatttttaatgaaaatttca Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGTTCATCGTGCTTCGAAAGTAC"
Proper citation: RRID:WB-STRAIN:WBStrain00005007 Copy
http://www.wormbase.org/db/get?name=WBStrain00000180
Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Source References: PMID:38714700
Synonyms: rmIs126.
Alternate IDs: WB-STRAIN:AM134, CGC_AM134
Notes: Made_by: S. Garcia/A Chavez|"Mutagen:Gamma Rays"|"rmIs126 [unc-54p::Q0::YFP]. Diffuse distribution of Q0::YFP throughout the body-wall muscle cells. [NOTE: (04/29/13) Strain is reported as incorrect -- apparently carries 20Q transgene. Working on obtaining a replacement.]"
Proper citation: RRID:WB-STRAIN:WBStrain00000180 Copy
http://www.wormbase.org/db/get?name=WBStrain00000204
Source Database: WormBase (WB)
Affected Genes: WBGene00004932(sod-3)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00004932(sod-3), WBGene00006789(unc-54)
Availability: unknown
Source References: PMID:24988428
Synonyms: dvIs14[unc-54/A1-42(pCL12)+mtl-2::GFP(pCL26);sod-3(gk235)X,
Alternate IDs: WB-STRAIN:ANM48
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00000204 Copy
http://www.wormbase.org/db/get?name=WBStrain00050683
Source Database: WormBase (WB)
Affected Genes: WBGene00003082(lsm-8)|WBGene00003514(myo-2)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003082(lsm-8), WBGene00003514(myo-2), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: lsm-8 (xe17[myo-2p::mCherry::unc-54 3'UTR]) IV/nT1 [qIs51] (IV;V); pkIs1582 V/nT1 [qIs51] (IV;V).
Notes: Made_by: Florian Aeschlimann|"pkIs1582 [let-858::GFP + rol-6(su1006)] V. Homozygous lethal lsm-8 deletion balanced by GFP-marked nT1 translocation. xe17 generated by CRISPR/Cas9-engineered replacement of the gene with a red pharyngeal marker. lsm-8 heterozygotes are wild-type (will roll in this case because of pkIs1582) green & red pharynx, and will segregate rolling heterozygotes (green & red pharynx), arrested nT1[qIs51] aneuploids (only green pharynx), and lsm-8 homozygotes (only red pharynx). Homozygous nT1[qIs51] inviable. Pick rollers with green & red pharynx and check for correct segregation of progeny to maintain. Reference: Mattout A, et al. Nat Cell Biol. 2020 May;22(5):579-590. PMID: 32251399"
Proper citation: RRID:WB-STRAIN:WBStrain00050683 Copy
http://www.wormbase.org/db/get?name=WBStrain00051096
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00022247(lgc-10)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00022247(lgc-10)
Availability: unknown
Source References: EMPTY
Synonyms: lgc-10(gk3709[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV.
Notes: Homozygous viable. Deletion of 769 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACTTCTTCCGCGTTTTCTAACCACTTTCC. Right flanking sequence: AGGTCAACGAGAAGTTATTGTTCCACAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00051096 Copy
http://www.wormbase.org/db/get?name=WBStrain00051095
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00021146(lgc-45)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00021146(lgc-45)
Availability: unknown
Source References: EMPTY
Synonyms: lgc-45(gk3708[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II.
Notes: Homozygous viable. Deletion of 761 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGAGGACCAATGGATCTACGAAGTAAGTTG. Right flanking sequence: CGGCGAAAAGACGCCATCGACAAAAATCCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00051095 Copy
http://www.wormbase.org/db/get?name=WBStrain00051094
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00011359(lgc-17)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00011359(lgc-17)
Availability: unknown
Source References: EMPTY
Synonyms: lgc-17(gk3707[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X.
Notes: Homozygous viable. Deletion of 972 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCGAAAAATTAAAGGAAATTGAACAGTAAG. Right flanking sequence: TGGAGGTGCAAGAGCCAGAAGAAAAAGTAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00051094 Copy
http://www.wormbase.org/db/get?name=WBStrain00051093
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: R08A2.2(gk3702[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V.
Notes: Homozygous viable. Deletion of 956 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGCATCTTCAGCTAGCAGCTTCTTCGGAGG. Right flanking sequence: CGGATGCATTCAATGACAAGCAGATTTACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00051093 Copy
http://www.wormbase.org/db/get?name=WBStrain00051099
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: T22C1.1(gk3772[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I.
Notes: Homozygous viable. Deletion of 1764 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTGCGCGAGGATGATTTGAAACTGGCGCCC. Right flanking sequence: TGGAAGAACAATTGCTGCTTCTGACATTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00051099 Copy
http://www.wormbase.org/db/get?name=WBStrain00051132
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00006937(wah-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00006937(wah-1)
Availability: unknown
Source References: EMPTY
Synonyms: wah-1(gk5392[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III.
Notes: Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 9220 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGTTTACACGCCCACCAATCTTCCCCGCCC. Right flanking sequence: TTCGGACCTTCACTGGATGTAGCTCGGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00051132 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within SPARC SAWG that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
