Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:mus musculus (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

12,978 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pBABEpuro-CMYC T58A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_53178 CMYC Mus musculus Ampicillin PMID:24717435 The mutations found during the QC process have no functional consequence. Backbone Size:5169; Vector Backbone:pBABE puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin T58A 2026-08-29 01:06:55 1
pcDNA3-Arl13b-PR-EGFP-TurboID
 
Resource Report
Resource Website 		RRID:Addgene_248196 The Arl13b noncilium targeting sequence-EGFP-TurboID Mus musculus Ampicillin PMID:38664376 Backbone Size:5382; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Truncated to only contain the PR domain 2026-08-29 01:25:48 0
UPA-DD with microexon
 
Resource Report
Resource Website 		RRID:Addgene_238353 Microexon E35a Mus musculus Ampicillin Microexon E35a sequence: gagacagagtcagatcaagatgatgag Vector Backbone:pCAGGS; Vector Types:Mammalian Expression, Other, TOPO TA vector; Bacterial Resistance:Ampicillin E35a (exon 35a) 2026-08-29 01:24:36 0
pAAV-ACTSTar-O2-GAD1-g2
 
Resource Report
Resource Website 		RRID:Addgene_225345 Gad1 Mus musculus Ampicillin Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin 2026-08-29 01:22:10 0
pAAV-ACTSTar-O2-SLC17a7-g3
 
Resource Report
Resource Website 		RRID:Addgene_225346 Slc17A7 Mus musculus Ampicillin Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin 2026-08-29 01:22:08 0
pAAV_hU6p_shRNA-mErbb4-#2_mSyn1p_EGFP
 
Resource Report
Resource Website 		RRID:Addgene_223310 shErbb4 Mus musculus Ampicillin PMID:39405910 Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-08-29 01:22:34 0
pTag4C_NLGN1-delPBM(TTRV)-CTEV-2xHA
 
Resource Report
Resource Website 		RRID:Addgene_223307 Nlgn1 without PBM - CTEV Mus musculus Kanamycin PMID:39405910 Vector Backbone:pTag4C; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin deleted PBM 2026-08-29 01:22:34 0
pTag4C_NLGN1
 
Resource Report
Resource Website 		RRID:Addgene_223305 Nlgn1 Mus musculus Kanamycin PMID:39405910 Vector Backbone:pTag4C; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:22:34 0
pAAV_hU6p_shRNA-mErbb4-#1_mSyn1p_EGFP
 
Resource Report
Resource Website 		RRID:Addgene_223309 shErbb4 Mus musculus Ampicillin PMID:39405910 Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-08-29 01:22:34 0
S100B mAb_HX552.1.1H11_HC_Mouse IgG2a
 
Resource Report
Resource Website 		RRID:Addgene_182908 anti-S100B (human) heavy chain Mus musculus Ampicillin Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin No 2026-08-29 01:15:31 0
S100B mAb_HX552.1.2D10_LC_Mouse Ig Kappa
 
Resource Report
Resource Website 		RRID:Addgene_182905 anti-S100B (human) light chain Mus musculus Ampicillin Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin No 2026-08-29 01:15:31 0
S100B mAb_HX552.1.2D10_HC_Mouse IgG2a
 
Resource Report
Resource Website 		RRID:Addgene_182904 anti-S100B (human) heavy chain Mus musculus Ampicillin Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin No 2026-08-29 01:15:31 0
S100B mAb_HX552.1.1D12_HC_Mouse IgG2a
 
Resource Report
Resource Website 		RRID:Addgene_182912 anti-S100B (human) heavy chain Mus musculus Ampicillin Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin No 2026-08-29 01:15:31 0
S100B mAb_HX552.1.1D12_LC_Mouse IgG2a
 
Resource Report
Resource Website 		RRID:Addgene_182913 anti-S100B (human) light chain Mus musculus Ampicillin Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin No 2026-08-29 01:15:31 0
pcDNA3.1 Opa1-K301A
 
Resource Report
Resource Website 		RRID:Addgene_191945 Opa1-K301A Mus musculus Ampicillin Vector Backbone:MSCV; Vector Types:Retroviral; Bacterial Resistance:Ampicillin K301A 2026-08-29 01:15:45 0
pBabePuro-FLAG-KrasnatG12D
 
Resource Report
Resource Website 		RRID:Addgene_206865 Kras Mus musculus Ampicillin PMID:36069770 Backbone Size:5086; Vector Backbone:pBabePuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin changed Glycine 12 to Aspartic Acid 2026-08-29 01:20:16 0
pCAG-SMPonlyver2-3xFLAG (1, 30-305)
 
Resource Report
Resource Website 		RRID:Addgene_253954 Pdzd8 Mus musculus Ampicillin PMID:40246839 Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin aa 2-29 and 306-1147 deleted 2026-08-29 01:27:22 0
Pvalb-2A-Flpo Flp-in replacement vector
 
Resource Report
Resource Website 		RRID:Addgene_61572 Pvalb-2A-Flpo Mus musculus Ampicillin PMID:25741722 Backbone Size:2682; Vector Backbone:pUC57; Vector Types:Recombinase-mediated cassette exchange using Flp recombinase; Bacterial Resistance:Ampicillin 2026-08-29 01:08:17 0
AAV-hRedOpsin-CD47
 
Resource Report
Resource Website 		RRID:Addgene_168479 CD47 Mus musculus Ampicillin PMID:34197341 Backbone Marker:Jeng-Shin Lee, Harvard University; Backbone Size:6079; Vector Backbone:AAV-MCS8; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-08-29 12:59:46 0
AAV-hSyn-Ribo-jGCaMP8m
 
Resource Report
Resource Website 		RRID:Addgene_167574 Ribo-GCaMP8m Mus musculus Ampicillin PMID:36739289 Backbone Size:2868; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-08-29 12:59:38 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. SPARC Anatomical Working Group Resources

    Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The Stimulating Peripheral Activity to Relieve Conditions (SPARC) effort is the result of National Institutes of Health’s (NIH) drive to map out the neural circuitry responsible for visceral control in higher vertebrates. The SPARC Anatomy Working Group (SAWG) is responsible for the integrity of anatomical knowledge in SPARC

Recent News Entries

Contact Us

Maryann Martone, Ph.D.

Department of Neurosciences, School of Medicine

University of California, San Diego

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch