Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pBABEpuro-CMYC T58A Resource Report Resource Website 1+ mentions |
RRID:Addgene_53178 | CMYC | Mus musculus | Ampicillin | PMID:24717435 | The mutations found during the QC process have no functional consequence. | Backbone Size:5169; Vector Backbone:pBABE puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | T58A | 2026-08-29 01:06:55 | 1 |
|
pcDNA3-Arl13b-PR-EGFP-TurboID Resource Report Resource Website |
RRID:Addgene_248196 | The Arl13b noncilium targeting sequence-EGFP-TurboID | Mus musculus | Ampicillin | PMID:38664376 | Backbone Size:5382; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Truncated to only contain the PR domain | 2026-08-29 01:25:48 | 0 | |
|
UPA-DD with microexon Resource Report Resource Website |
RRID:Addgene_238353 | Microexon E35a | Mus musculus | Ampicillin | Microexon E35a sequence: gagacagagtcagatcaagatgatgag | Vector Backbone:pCAGGS; Vector Types:Mammalian Expression, Other, TOPO TA vector; Bacterial Resistance:Ampicillin | E35a (exon 35a) | 2026-08-29 01:24:36 | 0 | |
|
pAAV-ACTSTar-O2-GAD1-g2 Resource Report Resource Website |
RRID:Addgene_225345 | Gad1 | Mus musculus | Ampicillin | Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-29 01:22:10 | 0 | |||
|
pAAV-ACTSTar-O2-SLC17a7-g3 Resource Report Resource Website |
RRID:Addgene_225346 | Slc17A7 | Mus musculus | Ampicillin | Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-29 01:22:08 | 0 | |||
|
pAAV_hU6p_shRNA-mErbb4-#2_mSyn1p_EGFP Resource Report Resource Website |
RRID:Addgene_223310 | shErbb4 | Mus musculus | Ampicillin | PMID:39405910 | Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-29 01:22:34 | 0 | ||
|
pTag4C_NLGN1-delPBM(TTRV)-CTEV-2xHA Resource Report Resource Website |
RRID:Addgene_223307 | Nlgn1 without PBM - CTEV | Mus musculus | Kanamycin | PMID:39405910 | Vector Backbone:pTag4C; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | deleted PBM | 2026-08-29 01:22:34 | 0 | |
|
pTag4C_NLGN1 Resource Report Resource Website |
RRID:Addgene_223305 | Nlgn1 | Mus musculus | Kanamycin | PMID:39405910 | Vector Backbone:pTag4C; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:22:34 | 0 | ||
|
pAAV_hU6p_shRNA-mErbb4-#1_mSyn1p_EGFP Resource Report Resource Website |
RRID:Addgene_223309 | shErbb4 | Mus musculus | Ampicillin | PMID:39405910 | Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-29 01:22:34 | 0 | ||
|
S100B mAb_HX552.1.1H11_HC_Mouse IgG2a Resource Report Resource Website |
RRID:Addgene_182908 | anti-S100B (human) heavy chain | Mus musculus | Ampicillin | Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin | No | 2026-08-29 01:15:31 | 0 | ||
|
S100B mAb_HX552.1.2D10_LC_Mouse Ig Kappa Resource Report Resource Website |
RRID:Addgene_182905 | anti-S100B (human) light chain | Mus musculus | Ampicillin | Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin | No | 2026-08-29 01:15:31 | 0 | ||
|
S100B mAb_HX552.1.2D10_HC_Mouse IgG2a Resource Report Resource Website |
RRID:Addgene_182904 | anti-S100B (human) heavy chain | Mus musculus | Ampicillin | Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin | No | 2026-08-29 01:15:31 | 0 | ||
|
S100B mAb_HX552.1.1D12_HC_Mouse IgG2a Resource Report Resource Website |
RRID:Addgene_182912 | anti-S100B (human) heavy chain | Mus musculus | Ampicillin | Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin | No | 2026-08-29 01:15:31 | 0 | ||
|
S100B mAb_HX552.1.1D12_LC_Mouse IgG2a Resource Report Resource Website |
RRID:Addgene_182913 | anti-S100B (human) light chain | Mus musculus | Ampicillin | Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin | No | 2026-08-29 01:15:31 | 0 | ||
|
pcDNA3.1 Opa1-K301A Resource Report Resource Website |
RRID:Addgene_191945 | Opa1-K301A | Mus musculus | Ampicillin | Vector Backbone:MSCV; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | K301A | 2026-08-29 01:15:45 | 0 | ||
|
pBabePuro-FLAG-KrasnatG12D Resource Report Resource Website |
RRID:Addgene_206865 | Kras | Mus musculus | Ampicillin | PMID:36069770 | Backbone Size:5086; Vector Backbone:pBabePuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | changed Glycine 12 to Aspartic Acid | 2026-08-29 01:20:16 | 0 | |
|
pCAG-SMPonlyver2-3xFLAG (1, 30-305) Resource Report Resource Website |
RRID:Addgene_253954 | Pdzd8 | Mus musculus | Ampicillin | PMID:40246839 | Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | aa 2-29 and 306-1147 deleted | 2026-08-29 01:27:22 | 0 | |
|
Pvalb-2A-Flpo Flp-in replacement vector Resource Report Resource Website |
RRID:Addgene_61572 | Pvalb-2A-Flpo | Mus musculus | Ampicillin | PMID:25741722 | Backbone Size:2682; Vector Backbone:pUC57; Vector Types:Recombinase-mediated cassette exchange using Flp recombinase; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:17 | 0 | ||
|
AAV-hRedOpsin-CD47 Resource Report Resource Website |
RRID:Addgene_168479 | CD47 | Mus musculus | Ampicillin | PMID:34197341 | Backbone Marker:Jeng-Shin Lee, Harvard University; Backbone Size:6079; Vector Backbone:AAV-MCS8; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-29 12:59:46 | 0 | ||
|
AAV-hSyn-Ribo-jGCaMP8m Resource Report Resource Website |
RRID:Addgene_167574 | Ribo-GCaMP8m | Mus musculus | Ampicillin | PMID:36739289 | Backbone Size:2868; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-29 12:59:38 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.