Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 1 showing 1 ~ 20 out of 33,936 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/71907

Species: Synthetic
Genetic Insert: dCas9-p65HSF1
Vector Backbone Description: Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26768771
Comments: Please visit http://casil.io for more information, updates, and protocols. For more information on Cheng Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/albert-cheng/

Proper citation: RRID:Addgene_71907 Copy   


http://www.addgene.org/71908

Species: Synthetic
Genetic Insert: PUFc-p65HSF1
Vector Backbone Description: Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26768771
Comments: Please visit http://casil.io for more information, updates, and protocols. For more information on Cheng Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/albert-cheng/

Proper citation: RRID:Addgene_71908 Copy   


http://www.addgene.org/71881

Species: Synthetic
Genetic Insert: NLSPUFa_VP64
Vector Backbone Description: Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26768771
Comments: Please visit http://casil.io for more information, updates, and protocols. For more information on Cheng Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/albert-cheng/

Proper citation: RRID:Addgene_71881 Copy   


http://www.addgene.org/71887

Species: Synthetic
Genetic Insert: dCas9-mCBPHAT
Vector Backbone Description: Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26768771
Comments: Please visit http://casil.io for more information, updates, and protocols. For more information on Cheng Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/albert-cheng/

Proper citation: RRID:Addgene_71887 Copy   


http://www.addgene.org/71879

Species: Synthetic
Genetic Insert: dCas9-VP64
Vector Backbone Description: Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26768771
Comments: Please visit http://casil.io for more information, updates, and protocols. For more information on Cheng Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/albert-cheng/

Proper citation: RRID:Addgene_71879 Copy   


  • RRID:Addgene_73169

    This resource has 1+ mentions.

http://www.addgene.org/73169

Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26768771
Comments: Please visit http://casil.io for more information, updates and protocols

Proper citation: RRID:Addgene_73169 Copy   


  • RRID:Addgene_73689

    This resource has 1+ mentions.

http://www.addgene.org/73689

Species: Synthetic
Genetic Insert: Clover_PUFc
Vector Backbone Description: Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26768771
Comments: Please visit http://casil.io for more information, updates and protocols

Proper citation: RRID:Addgene_73689 Copy   


http://www.addgene.org/73688

Species: Synthetic
Genetic Insert: Clover_PUFa
Vector Backbone Description: Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26768771
Comments: Please visit http://casil.io for more information, updates and protocols

Proper citation: RRID:Addgene_73688 Copy   


  • RRID:Addgene_73690

    This resource has 1+ mentions.

http://www.addgene.org/73690

Species: Synthetic
Genetic Insert: mRuby2_PUFa
Vector Backbone Description: Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26768771
Comments: Please visit http://casil.io for more information, updates and protocols

Proper citation: RRID:Addgene_73690 Copy   


http://www.addgene.org/73697

Species: Synthetic
Genetic Insert: PUFb_p65HSF1
Vector Backbone Description: Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26768771
Comments: Please visit http://casil.io for more information, updates and protocols

Proper citation: RRID:Addgene_73697 Copy   


  • RRID:Addgene_66069

http://www.addgene.org/66069

Species: Synthetic
Genetic Insert: None
Vector Backbone Description: Vector Backbone:DVK; Vector Types:Synthetic Biology, Other, Destination Vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26479688
Comments: parts.igem.org/Part:pSB1K3

Proper citation: RRID:Addgene_66069 Copy   


  • RRID:Addgene_66067

http://www.addgene.org/66067

Species: Synthetic
Genetic Insert: None
Vector Backbone Description: Vector Backbone:DVK; Vector Types:Synthetic Biology, Other, Destination Vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26479688
Comments: parts.igem.org/Part:pSB1K3

Proper citation: RRID:Addgene_66067 Copy   


  • RRID:Addgene_66071

http://www.addgene.org/66071

Species: Synthetic
Genetic Insert: None
Vector Backbone Description: Vector Backbone:DVK; Vector Types:Gateway Cloning, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26479688
Comments: parts.igem.org/Part:pSB1K3

Proper citation: RRID:Addgene_66071 Copy   


  • RRID:Addgene_68307

http://www.addgene.org/68307

Genetic Insert: 2xtRNA-SupD
Vector Backbone Description: Vector Backbone:pKD; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26350500
Comments: See supplementary information accompanying article for additional cloning information. We recommend introducing this plasmid into a recoded strain of E. coli (no genomic TAG codons) for high-efficiency phoshoprotein expression.

Proper citation: RRID:Addgene_68307 Copy   


  • RRID:Addgene_55925

http://www.addgene.org/55925

Species: Homo sapiens
Genetic Insert: Zyxin
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mRFP1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 584; Emission = 607

Proper citation: RRID:Addgene_55925 Copy   


  • RRID:Addgene_56533

http://www.addgene.org/56533

Species: Homo sapiens
Genetic Insert: H2B
Vector Backbone Description: Backbone Size:4750; Vector Backbone:rsEGFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_56533 Copy   


  • RRID:Addgene_58029

    This resource has 1+ mentions.

http://www.addgene.org/58029

Species: Homo sapiens
Genetic Insert: NM_003380.3
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mTagRFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18454154
Comments: . Excitation = 555; Emission = 584

Proper citation: RRID:Addgene_58029 Copy   


  • RRID:Addgene_63161

http://www.addgene.org/63161

Genetic Insert: DV2 prM-E
Vector Backbone Description: Vector Backbone:pVRC8400; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29999491
Comments: Please visit https://www.biorxiv.org/content/early/2018/03/22/286955 for bioRxiv preprint.

Proper citation: RRID:Addgene_63161 Copy   


http://www.addgene.org/54887

Species: Homo sapiens
Genetic Insert: Desmoglein1
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mApple-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 568; Emission = 592

Proper citation: RRID:Addgene_54887 Copy   


  • RRID:Addgene_55187

http://www.addgene.org/55187

Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:7701; Vector Backbone:pET, pCoofy4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23410102
Comments: C-terminal tags are separated by a stop codon. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene. Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer: LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3' LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest: none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3' 10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3' StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3' S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3' CBP - SLIC Primer 5`ATGAAGCGGCGGTGGAAGAAAAAC 3' HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3' Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3' Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.

Proper citation: RRID:Addgene_55187 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. SPARC Anatomical Working Group Resources

    Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within SPARC SAWG that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X