Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:kanamycin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

33,936 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pAC1410-pmax-dCas9Master_p65HSF1
 
Resource Report
Resource Website 		RRID:Addgene_71907 dCas9-p65HSF1 Synthetic Kanamycin PMID:26768771 Please visit http://casil.io for more information, updates, and protocols. For more information on Cheng Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/albert-cheng/ Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:09:47 0
pAC1411-pmax-NLSPUFc_p65HSF1
 
Resource Report
Resource Website 		RRID:Addgene_71908 PUFc-p65HSF1 Synthetic Kanamycin PMID:26768771 Please visit http://casil.io for more information, updates, and protocols. For more information on Cheng Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/albert-cheng/ Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:09:47 0
pAC1355-pmax-NLSPUFa_VP64
 
Resource Report
Resource Website 		RRID:Addgene_71881 NLSPUFa_VP64 Synthetic Kanamycin PMID:26768771 Please visit http://casil.io for more information, updates, and protocols. For more information on Cheng Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/albert-cheng/ Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:09:46 0
pAC1364-pmax-dCas9Master_mCBPHAT
 
Resource Report
Resource Website 		RRID:Addgene_71887 dCas9-mCBPHAT Synthetic Kanamycin PMID:26768771 Please visit http://casil.io for more information, updates, and protocols. For more information on Cheng Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/albert-cheng/ Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-08-29 01:09:46 0
pAC164-pmax-dCas9Master-VP64
 
Resource Report
Resource Website 		RRID:Addgene_71879 dCas9-VP64 Synthetic Kanamycin PMID:26768771 Please visit http://casil.io for more information, updates, and protocols. For more information on Cheng Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/albert-cheng/ Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:09:46 0
pAC1445-pmax-dCas9
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_73169 dCas9 Synthetic Kanamycin PMID:26768771 Please visit http://casil.io for more information, updates and protocols Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-08-29 01:10:00 2
pAC1447_pmax-Clover_PUFc
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_73689 Clover_PUFc Synthetic Kanamycin PMID:26768771 Please visit http://casil.io for more information, updates and protocols Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:10:05 3
pAC1446_pmax-Clover_PUFa
 
Resource Report
Resource Website 		RRID:Addgene_73688 Clover_PUFa Synthetic Kanamycin PMID:26768771 Please visit http://casil.io for more information, updates and protocols Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:10:05 0
pAC1448_pmax-mRuby2_PUFa
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_73690 mRuby2_PUFa Synthetic Kanamycin PMID:26768771 Please visit http://casil.io for more information, updates and protocols Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:10:05 1
pAC1392_pmax-PUFb_p65HSF1
 
Resource Report
Resource Website 		RRID:Addgene_73697 PUFb_p65HSF1 Synthetic Kanamycin PMID:26768771 Please visit http://casil.io for more information, updates and protocols Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:10:05 0
DVK_EF
 
Resource Report
Resource Website 		RRID:Addgene_66069 None Synthetic Kanamycin PMID:26479688 parts.igem.org/Part:pSB1K3 Vector Backbone:DVK; Vector Types:Synthetic Biology, Other, Destination Vector; Bacterial Resistance:Kanamycin 2026-08-29 01:08:56 0
DVK_AE
 
Resource Report
Resource Website 		RRID:Addgene_66067 None Synthetic Kanamycin PMID:26479688 parts.igem.org/Part:pSB1K3 Vector Backbone:DVK; Vector Types:Synthetic Biology, Other, Destination Vector; Bacterial Resistance:Kanamycin 2026-08-29 01:09:01 0
DVK_GH
 
Resource Report
Resource Website 		RRID:Addgene_66071 None Synthetic Kanamycin PMID:26479688 parts.igem.org/Part:pSB1K3 Vector Backbone:DVK; Vector Types:Gateway Cloning, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-29 01:08:56 0
SupD
 
Resource Report
Resource Website 		RRID:Addgene_68307 2xtRNA-SupD Kanamycin PMID:26350500 See supplementary information accompanying article for additional cloning information. We recommend introducing this plasmid into a recoded strain of E. coli (no genomic TAG codons) for high-efficiency phoshoprotein expression. Vector Backbone:pKD; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-29 01:09:15 0
mRFP1-Zyxin-6
 
Resource Report
Resource Website 		RRID:Addgene_55925 Zyxin Homo sapiens Kanamycin . Excitation = 584; Emission = 607 Backbone Size:4750; Vector Backbone:mRFP1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:07:26 0
rsEGFP2-H2B-6
 
Resource Report
Resource Website 		RRID:Addgene_56533 H2B Homo sapiens Kanamycin Backbone Size:4750; Vector Backbone:rsEGFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin D26G and V119I in H2B 2026-08-29 01:07:31 0
mTagRFP-T-Vimentin-7
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_58029 NM_003380.3 Homo sapiens Kanamycin PMID:18454154 . Excitation = 555; Emission = 584 Backbone Size:4750; Vector Backbone:mTagRFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:07:48 2
DV2 VLPs pVRC8400
 
Resource Report
Resource Website 		RRID:Addgene_63161 DV2 prM-E Kanamycin PMID:29999491 Please visit https://www.biorxiv.org/content/early/2018/03/22/286955 for bioRxiv preprint. Vector Backbone:pVRC8400; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:08:30 0
mApple-Desmoglein1-C-18
 
Resource Report
Resource Website 		RRID:Addgene_54887 Desmoglein1 Homo sapiens Kanamycin . Excitation = 568; Emission = 592 Backbone Size:4750; Vector Backbone:mApple-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:07:13 0
pCoofy49
 
Resource Report
Resource Website 		RRID:Addgene_55187 Kanamycin PMID:23410102 C-terminal tags are separated by a stop codon. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene. Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer: LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3' LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest: none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3' 10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3' StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3' S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3' CBP - SLIC Primer 5`ATGAAGCGGCGGTGGAAGAAAAAC 3' HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3' Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3' Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected. Backbone Marker:Novagen; Backbone Size:7701; Vector Backbone:pET, pCoofy4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:07:17 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. SPARC Anatomical Working Group Resources

    Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The Stimulating Peripheral Activity to Relieve Conditions (SPARC) effort is the result of National Institutes of Health’s (NIH) drive to map out the neural circuitry responsible for visceral control in higher vertebrates. The SPARC Anatomy Working Group (SAWG) is responsible for the integrity of anatomical knowledge in SPARC

Recent News Entries

Contact Us

Maryann Martone, Ph.D.

Department of Neurosciences, School of Medicine

University of California, San Diego

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch