Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Other
Genetic Insert: T38M-P750-luxAB-DAS+4
Vector Backbone Description: Backbone Size:6465; Vector Backbone:pDE43-MEH; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:24191058
Proper citation: RRID:Addgene_49520 Copy
Species: Other
Genetic Insert: P750-luxAB-DAS+4
Vector Backbone Description: Backbone Size:6465; Vector Backbone:pDE43-MEH; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:24191058
Proper citation: RRID:Addgene_49519 Copy
Species: Homo sapiens
Genetic Insert: grass pollen allergen Phl p 7 specific human epsilon heavy chain expression cassette
Vector Backbone Description: Backbone Marker:InvivoGen; Backbone Size:6491; Vector Backbone:pVITRO1-hygro-mcs; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:25073855
Proper citation: RRID:Addgene_50365 Copy
Species: Homo sapiens
Genetic Insert: grass pollen allergen Phl p 7 specific human Gamma 1 heavy chain expression cassette
Vector Backbone Description: Backbone Marker:InvivoGen; Backbone Size:6491; Vector Backbone:pVITRO1-hygro-mcs; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:25073855
Proper citation: RRID:Addgene_50366 Copy
Species: Homo sapiens
Genetic Insert: grass pollen allergen Phl p 7 specific human Gamma 4 heavy chain expression cassette
Vector Backbone Description: Backbone Marker:InvivoGen; Backbone Size:6491; Vector Backbone:pVITRO1-hygro-mcs; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:25073855
Proper citation: RRID:Addgene_50369 Copy
Species: Homo sapiens
Genetic Insert: grass pollen allergen Phl p 7 specific human Gamma 3 heavy chain expression cassette
Vector Backbone Description: Backbone Marker:InvivoGen; Backbone Size:6491; Vector Backbone:pVITRO1-hygro-mcs; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:25073855
Proper citation: RRID:Addgene_50368 Copy
Species: Pyrophorus plagiophthalamus
Genetic Insert: Click beetle red luciferase (optimized for Mycobacteria)
Vector Backbone Description: Backbone Marker:JD Cirillo; Backbone Size:4809; Vector Backbone:pJDC89; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:25265287
Proper citation: RRID:Addgene_60853 Copy
Species: Mycobacterium marinum
Genetic Insert: lpqZ
Vector Backbone Description: Backbone Size:5720; Vector Backbone:pSMT3; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:41384969
Proper citation: RRID:Addgene_240159 Copy
Species: Mycobacterium marinum
Genetic Insert: fecB (MMAR_1650)
Vector Backbone Description: Vector Backbone:pSMT3; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:41384969
Proper citation: RRID:Addgene_240158 Copy
Species: Streptococcus pyogenes
Genetic Insert: S. pyogenes Cas9
Vector Backbone Description: Vector Backbone:2-micron/pUC; Vector Types:Yeast Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Hygromycin
Defining Citation: PMID:35708612
Comments: Part of the Markerless Yeast Localization and Overexpression (MyLO) CRISPR-Cas9 Toolkit. Vector cloned by homologous recombination in yeast following BglI/II digestion
Proper citation: RRID:Addgene_179079 Copy
Species: n/a
Genetic Insert: MG1655.ΔTAG.ΔTGA.ΔprfA.mprfB3.A37G-tRNA-Trp
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:Hygromycin
Defining Citation: PMID:39910296
Proper citation: RRID:Addgene_234622 Copy
Species: Plasmodiophora brassicae
Genetic Insert: PbGH3
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Backbone Size:10141; Vector Backbone:pMDC32; Vector Types:Plant Expression; Bacterial Resistance:Hygromycin
Proper citation: RRID:Addgene_232335 Copy
Species: Mycobacterium tuberculosis
Genetic Insert: PPE18-ALFA
Vector Backbone Description: Backbone Marker:Bryson Lab; Backbone Size:6512; Vector Backbone:pBB115; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Proper citation: RRID:Addgene_231247 Copy
Species: Mycobacterium tuberculosis
Genetic Insert: PPE18-HA
Vector Backbone Description: Backbone Size:6512; Vector Backbone:pBB115; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Proper citation: RRID:Addgene_231246 Copy
Species: Escherichia coli
Genetic Insert: Deficient in the P2 bacteriophage packaging cos site; rhamnose-inducible P4 delta (δ) and epsilon (ε) genes
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Hygromycin
Defining Citation: PMID:33317264
Comments: P2 bacteriophage lysogen derived from E. coli EMG C-5545 strain.
We designed a pair of primers to check the presence of P2 lysogen in this strain:
- P2 gpH C-ter gpG Fw: 5’ GCAGAGCACGAACAGTCACG 3’
- P2 gpH C-ter gpG Rv: 5’ TTATTGCGGCATTTCCGGCC 3’
These primers amplify the C-terminal region of the P2 gpH gene (tail fiber) and the complete gpG gene (tail fiber chaperone) (PCR fragment size: 2070 bp).
Proper citation: RRID:Addgene_209018 Copy
Vector Backbone Description: Backbone Size:9915; Vector Backbone:pBAC2015, pGM1190, and pUC19; Vector Types:; Bacterial Resistance:Hygromycin
Defining Citation: PMID:39666857
Proper citation: RRID:Addgene_227580 Copy
Species: Synthetic
Genetic Insert: EBFP2-NES
Vector Backbone Description: Backbone Marker:InvivoGen; Backbone Size:6491; Vector Backbone:pVITRO1-hygro-mcs; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:34838160
Proper citation: RRID:Addgene_184461 Copy
Species: Synthetic
Genetic Insert: TagRFP-NES
Vector Backbone Description: Backbone Marker:InvivoGen; Backbone Size:6491; Vector Backbone:pVITRO1-hygro-mcs; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:34838160
Proper citation: RRID:Addgene_184449 Copy
Species: Synthetic
Genetic Insert: TagRFP-CAAX
Vector Backbone Description: Backbone Marker:InvivoGen; Backbone Size:6491; Vector Backbone:pVITRO1-hygro-mcs; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:34838160
Proper citation: RRID:Addgene_184447 Copy
Species: Synthetic
Genetic Insert: iRFP702-CAAX
Vector Backbone Description: Backbone Marker:InvivoGen; Backbone Size:6491; Vector Backbone:pVITRO1-hygro-mcs; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:34838160
Proper citation: RRID:Addgene_184455 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within SPARC SAWG that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
