Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 1 showing 1 ~ 20 out of 742,877 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:DGRC_1381486

https://dgrc.bio.indiana.edu/product/View?product=1381486

Species: Drosophila melanogaster
Defining Citation: PMID:16326860
Comments: BDGP iPCR Collection

Proper citation: RRID:DGRC_1381486 Copy   


  • RRID:DGRC_1604016

https://dgrc.bio.indiana.edu/product/View?product=1604016

Species: Drosophila melanogaster
Defining Citation: PMID:16326860
Comments: BDGP iPCR Collection

Proper citation: RRID:DGRC_1604016 Copy   


  • RRID:Addgene_209749

http://www.addgene.org/209749

Species: Homo sapiens
Genetic Insert: MS4A1
Vector Backbone Description: Backbone Marker:Feng Zhang (Addgene plasmid # 52961); Backbone Size:14873; Vector Backbone:lentiCRISPR v2; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37683180
Comments: Can be used to knockout the human CD20 gene, MS4A1. After which, pCDH-V1-rCD20-BSD, pCDH-V2-rCD20-BSD or pCDH-V3-rCD20-BSD can be used to reconstitute CD20 expression with either variants 1, 2 or 3 mRNA isoforms of CD20.

Proper citation: RRID:Addgene_209749 Copy   


  • RRID:Addgene_209750

http://www.addgene.org/209750

Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Feng Zhang (Addgene plasmid # 52961); Backbone Size:14873; Vector Backbone:lentiCRISPR v2; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37683180

Proper citation: RRID:Addgene_209750 Copy   


  • RRID:Addgene_210178

http://www.addgene.org/210178

Species: Saccharomyces cerevisiae
Genetic Insert: YIp ADE2-LEU2 pTDH3::aro7-G141S-GFP::tADH1
Vector Backbone Description: Vector Backbone:pRH3022; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37729018

Proper citation: RRID:Addgene_210178 Copy   


  • RRID:Addgene_209759

http://www.addgene.org/209759

Species: Homo sapiens
Genetic Insert: MS4A1
Vector Backbone Description: Backbone Marker:Systembio; Backbone Size:7133; Vector Backbone:pCDH-CMV-MCS; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37683180

Proper citation: RRID:Addgene_209759 Copy   


  • RRID:Addgene_209756

http://www.addgene.org/209756

Species: Homo sapiens
Genetic Insert: MS4A1
Vector Backbone Description: Backbone Marker:Systembio; Backbone Size:7133; Vector Backbone:pCDH-CMV-MCS; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37683180

Proper citation: RRID:Addgene_209756 Copy   


  • RRID:Addgene_209757

http://www.addgene.org/209757

Species: Homo sapiens
Genetic Insert: MS4A1
Vector Backbone Description: Backbone Marker:Systembio; Backbone Size:7133; Vector Backbone:pCDH-CMV-MCS; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37683180

Proper citation: RRID:Addgene_209757 Copy   


  • RRID:Addgene_201470

http://www.addgene.org/201470

Species: Homo sapiens
Genetic Insert: RILPL1
Vector Backbone Description: Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38091401
Comments: Please visit https://www.biorxiv.org/content/10.1101/2023.06.07.544051v3 for bioRxiv preprint.

Proper citation: RRID:Addgene_201470 Copy   


  • RRID:Addgene_209752

http://www.addgene.org/209752

Species: Homo sapiens
Genetic Insert: MS4A1
Vector Backbone Description: Backbone Size:7456; Vector Backbone:pCDH-IRES-BSD; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37683180
Comments: Lentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 1 mRNA isoform of CD20. The "CCTGGGGGGTCTTCTGATGATCC" sequence within the CDS of MS4A1 was altered with synonymous substitutions to "GTTGGGCGGACTACTTATGATTC" to avoid recognition by the gRNA from LentiCRISPRv2-sgCD20. This allows for the rescue of CD20 expression after LentiCRISPRv2-sgCD20 vector-mediated knockout.

Proper citation: RRID:Addgene_209752 Copy   


  • RRID:Addgene_209753

http://www.addgene.org/209753

Species: Homo sapiens
Genetic Insert: MS4A1
Vector Backbone Description: Backbone Size:7456; Vector Backbone:pCDH-IRES-BSD; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37683180
Comments: Lentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 2 mRNA isoform of CD20. The "CCTGGGGGGTCTTCTGATGATCC" sequence within the CDS of MS4A1 was altered with synonymous substitutions to "GTTGGGCGGACTACTTATGATTC" to avoid recognition by the gRNA from LentiCRISPRv2-sgCD20. This allows for the rescue of CD20 expression after LentiCRISPRv2-sgCD20 vector-mediated knockout.

Proper citation: RRID:Addgene_209753 Copy   


  • RRID:Addgene_209754

http://www.addgene.org/209754

Species: Homo sapiens
Genetic Insert: MS4A1
Vector Backbone Description: Backbone Size:7456; Vector Backbone:pCDH-IRES-BSD; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37683180
Comments: Lentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 3 mRNA isoform of CD20. The "CCTGGGGGGTCTTCTGATGATCC" sequence within the CDS of MS4A1 was altered with synonymous substitutions to "GTTGGGCGGACTACTTATGATTC" to avoid recognition by the gRNA from LentiCRISPRv2-sgCD20. This allows for the rescue of CD20 expression after LentiCRISPRv2-sgCD20 vector-mediated knockout.

Proper citation: RRID:Addgene_209754 Copy   


  • RRID:Addgene_210181

http://www.addgene.org/210181

Species: Saccharomyces cerevisiae
Genetic Insert: YIp ADE2-LEU2 pTDH3::lys1-W353G-GFP::tADH1
Vector Backbone Description: Vector Backbone:pRH3022; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37729018

Proper citation: RRID:Addgene_210181 Copy   


  • RRID:Addgene_205966

http://www.addgene.org/205966

Species: Selenomonas sp. isolate RGIG9219 Water_deer_Rumen (MAG), JAGBLH010000220
Genetic Insert: Cas8-HNH proteins and CRISPR array
Vector Backbone Description: Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:37995242

Proper citation: RRID:Addgene_205966 Copy   


http://www.addgene.org/194703

Species: Homo sapiens
Genetic Insert: RPS2
Vector Backbone Description: Backbone Size:10863; Vector Backbone:pLIX403_Capture1_APOBEC_HA_P2A_mRuby; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33963355

Proper citation: RRID:Addgene_194703 Copy   


  • RRID:Addgene_202853

http://www.addgene.org/202853

Species: Synthetic
Genetic Insert: EGFP/BC12
Vector Backbone Description: Vector Backbone:pCER206; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37321219
Comments: Please note: Plasmid contains a M234K mutation in EGFP. This mutation is not expected to affect plasmid function.

Proper citation: RRID:Addgene_202853 Copy   


  • RRID:Addgene_205964

http://www.addgene.org/205964

Species: Sulfitobacter sp. JL08, NZ_CP025815
Genetic Insert: DinG HNH crRNA
Vector Backbone Description: Vector Backbone:pColADuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37995242

Proper citation: RRID:Addgene_205964 Copy   


  • RRID:Addgene_205969

http://www.addgene.org/205969

Species: Candidatus Cloacimonetes bacterium (MAG), MWEE01000013
Genetic Insert: Cas5-HNH proteins and CRISPR array
Vector Backbone Description: Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:37995242

Proper citation: RRID:Addgene_205969 Copy   


http://www.addgene.org/208039

Species: Homo sapiens
Genetic Insert: PML (isoform IVa; 3MAS)
Vector Backbone Description: Vector Backbone:Derived from Addgene ID# 52962 (Zhang Lab).; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34795231
Comments: Control for PMLiva SUMO-ID experiments; 3MAS mutant lacks major SUMOylation sites and SIM domain.

Proper citation: RRID:Addgene_208039 Copy   


http://www.addgene.org/208035

Species: Homo sapiens
Genetic Insert: SUMO1nc
Vector Backbone Description: Backbone Marker:Open Biosystems; Vector Backbone:TRIPZ; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34795231
Comments: Lentiviral packaging of TRIPZ is more efficient with TAT expression (e.g using pcDNA1-TatHIV Addgene ID: 138478) and 2nd generation gag/pol/env combination (e.g. using PSPAX2 Addgene ID: 12260 and pMD2.G Addgene ID: 12259); SUMO1nc is excisable using EcoR1-Mlu1.

Proper citation: RRID:Addgene_208035 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. SPARC Anatomical Working Group Resources

    Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within SPARC SAWG that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X