Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 1 showing 1 ~ 20 out of 228 results
Snippet view Table view Download 228 Result(s)
Click the to add this resource to a Collection
  • RRID:Addgene_49796

    This resource has 1+ mentions.

http://www.addgene.org/49796

Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5000; Vector Backbone:pCDFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:23651248

Proper citation: RRID:Addgene_49796 Copy   


  • RRID:Addgene_49763

    This resource has 1+ mentions.

http://www.addgene.org/49763

Genetic Insert: genotype: rpsL, thr, leu, thi, lacY, galK, galT, ara, tomA, tsx, dam, dcm, supE44, Δ(lac-proAB), [F' traD36, proAB, lacIqZΔM15]
Vector Backbone Description: Vector Backbone:N/A; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:2985470

Proper citation: RRID:Addgene_49763 Copy   


  • RRID:Addgene_52258

    This resource has 1+ mentions.

http://www.addgene.org/52258

Species: Homo sapiens
Genetic Insert: SUMO-1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:25007328

Proper citation: RRID:Addgene_52258 Copy   


  • RRID:Addgene_52263

http://www.addgene.org/52263

Species: Homo sapiens
Genetic Insert: SUMO-3
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:25007328

Proper citation: RRID:Addgene_52263 Copy   


  • RRID:Addgene_52261

http://www.addgene.org/52261

Species: Homo sapiens
Genetic Insert: SUMO-1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:25007328

Proper citation: RRID:Addgene_52261 Copy   


  • RRID:Addgene_247069

http://www.addgene.org/247069

Species: Escherichia coli K-12 W3110
Genetic Insert: E.coli Type I-E CRISPR cas
Vector Backbone Description: Backbone Marker:N/A; Backbone Size:2300; Vector Backbone:pCDF; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Streptomycin
Defining Citation: PMID:41290661

Proper citation: RRID:Addgene_247069 Copy   


  • RRID:Addgene_198026

http://www.addgene.org/198026

Species: Synthetic
Genetic Insert: T0 terminator - Sm resistance cassette
Vector Backbone Description: Backbone Size:4948; Vector Backbone:pSH624-ssr; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:37798358

Proper citation: RRID:Addgene_198026 Copy   


  • RRID:Addgene_241263

http://www.addgene.org/241263

Species: E. coli
Genetic Insert: dnaQ
Vector Backbone Description: Vector Backbone:pCDFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin

Proper citation: RRID:Addgene_241263 Copy   


http://www.addgene.org/229515

Species: Anthoceros agrestis
Genetic Insert: Rubisco accumulation factor 1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39491367
Comments: Removal of Anthoceros agrestis RbcX2 and RbcX1 from pCDF_AaRaf1/Raf2/RbcX2/BSD2/RbcX1 was performed by Genscript.

Proper citation: RRID:Addgene_229515 Copy   


http://www.addgene.org/229510

Species: Arabidopsis thaliana
Genetic Insert: Rubisco accumulation factor 1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39491367
Comments: Gene Synthesis from Genscript. Design of the Rubisco assembly factor inserts was mirroring pAtR1/R2/RX/B2 as shown in Aigner et al 2017 (10.1126/science.aap9221), with the addition of RbcX isoform, RbcXI after the BSD2 gene.

Proper citation: RRID:Addgene_229510 Copy   


http://www.addgene.org/229511

Species: Arabidopsis thaliana
Genetic Insert: Rubisco accumulation factor 1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39491367
Comments: Gene Synthesis from Genscript. Design of the three Rubisco assembly factor inserts was mirroring pAtR1/R2/RX/B2 as shown in Aigner et al 2017 (10.1126/science.aap9221).

Proper citation: RRID:Addgene_229511 Copy   


http://www.addgene.org/229513

Species: Anthoceros agrestis
Genetic Insert: Rubisco accumulation factor 1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39491367
Comments: Removal of Anthoceros agrestis Raf2 from pCDF_AaRaf1/Raf2/RbcX2/BSD2/RbcX1 was performed by Genscript.

Proper citation: RRID:Addgene_229513 Copy   


http://www.addgene.org/229507

Species: Anthoceros agrestis
Genetic Insert: Rubisco accumulation factor 1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39491367
Comments: Fragments of assembly factors , with T7 promoter and terminator, with type II restriction cut sites at both ends were ordered from Twist Bioscience, construct was formed with a golden gate pot reaction to an receiver pCDF backbone.

Proper citation: RRID:Addgene_229507 Copy   


http://www.addgene.org/229509

Species: Anthoceros agrestis
Genetic Insert: Rubisco accumulation factor 1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39491367
Comments: Gene Synthesis from Genscript. Each assembly factor is regulated by a individual T7 promoter and terminator.

Proper citation: RRID:Addgene_229509 Copy   


http://www.addgene.org/229508

Species: Anthoceros agrestis
Genetic Insert: Rubisco accumulation factor 1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39491367
Comments: Fragments of assembly factors , with T7 promoter and terminator, with type II restriction cut sites at both ends were ordered from Twist Bioscience, construct was formed with a golden gate pot reaction to an receiver pCDF backbone.

Proper citation: RRID:Addgene_229508 Copy   


  • RRID:Addgene_229736

http://www.addgene.org/229736

Vector Backbone Description: Vector Backbone:pUC; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:40645610

Proper citation: RRID:Addgene_229736 Copy   


  • RRID:Addgene_227664

http://www.addgene.org/227664

Species: Synthetic
Genetic Insert: msfGFP
Vector Backbone Description: Backbone Size:4730; Vector Backbone:pBAMD1-4; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39778677

Proper citation: RRID:Addgene_227664 Copy   


  • RRID:Addgene_225083

http://www.addgene.org/225083

Species: Chryseobacterium sp. JM1
Genetic Insert: ChrH
Vector Backbone Description: Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:37252350
Comments: Also encodes ChrI (no tag)

Proper citation: RRID:Addgene_225083 Copy   


  • RRID:Addgene_227668

http://www.addgene.org/227668

Species: BxbI phage
Genetic Insert: SmR
Vector Backbone Description: Backbone Size:6370; Vector Backbone:pFNC-6; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39778677

Proper citation: RRID:Addgene_227668 Copy   


  • RRID:Addgene_98417

    This resource has 1+ mentions.

http://www.addgene.org/98417

Genetic Insert: Genotype: MC4100 ∆clpPX
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27732583
Comments: Strain DHL708 was built by deleting the clpPX operon with lambda-Red mediated homologous recombination. The FRT-flanked Kan cassette was then flipped out using the FLP recombinase (pCP20). The deletion region can be PCR-amplified and sequenced using the primers CCGCTCGAGTTTACGCAGCATAACGCGCTAAATTC and CGTCAGTATATGGGGATGTTTCCCC. Originally described in Landgraf, D., Okumus, B., Chien, P., Baker, T. A. & Paulsson, J. Segregation of molecules at cell division reveals native protein localization. Nat Methods 9, 480–482 (2012).

Proper citation: RRID:Addgene_98417 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. SPARC Anatomical Working Group Resources

    Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within SPARC SAWG that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X