Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 1 showing 1 ~ 20 out of 566 results
Snippet view Table view Download 566 Result(s)
Click the to add this resource to a Collection
  • RRID:Addgene_71265

http://www.addgene.org/71265

Species: Other
Genetic Insert: VenusYFP
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR/Zeo; Vector Types:Gateway Cloning; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:26644504

Proper citation: RRID:Addgene_71265 Copy   


  • RRID:Addgene_73314

http://www.addgene.org/73314

Species: Komagataella pastoris
Genetic Insert: Pas2p (peroxisomal membrane targeting region)
Vector Backbone Description: Backbone Size:3329; Vector Backbone:pPICZA; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)

Proper citation: RRID:Addgene_73314 Copy   


  • RRID:Addgene_73317

http://www.addgene.org/73317

Species: Crepis alpina
Genetic Insert: delta-12 fatty acid acetylenase
Vector Backbone Description: Backbone Size:3329; Vector Backbone:pPICZA; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)

Proper citation: RRID:Addgene_73317 Copy   


  • RRID:Addgene_68306

    This resource has 10+ mentions.

http://www.addgene.org/68306

Genetic Insert: None
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:26350500
Comments: Derived from Lajoie, et. al., Genomically recoded organisms expand biological functions, Science, 2013, with the following genomic modifications: ΔmutS:zeo, ΔtolC, Δbla:tolC, SerB-/ΔSerB

Proper citation: RRID:Addgene_68306 Copy   


  • RRID:Addgene_48733

    This resource has 1+ mentions.

http://www.addgene.org/48733

Species: Discosoma sp
Genetic Insert: dsRed-Express
Vector Backbone Description: Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:17603495
Comments: This plasmid is nearly identical to pRwB (http://www.addgene.org/48734), except that it contains a 2kb stuffer region to bring its size closer to the ~8kb native papillomavirus genome. For more information on using this plasmid, please see the following website: http://home.ccr.cancer.gov/Lco/target.htm

Proper citation: RRID:Addgene_48733 Copy   


  • RRID:Addgene_48734

    This resource has 1+ mentions.

http://www.addgene.org/48734

Species: Discosoma sp
Genetic Insert: dsRed-Express
Vector Backbone Description: Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:19073722
Comments: Note that this plasmid is substantially smaller than the ~8kb native papillomavirus genome. There is a second version of this plasmid with a 2kb stuffer region that is available here: http://www.addgene.org/48733 . Further information can be found here: http://home.ccr.cancer.gov/Lco/target.htm

Proper citation: RRID:Addgene_48734 Copy   


  • RRID:Addgene_48677

    This resource has 1+ mentions.

http://www.addgene.org/48677

Species: Synthetic
Genetic Insert: TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:24076762

Proper citation: RRID:Addgene_48677 Copy   


  • RRID:Addgene_49018

    This resource has 10+ mentions.

http://www.addgene.org/49018

Species: E. coli
Genetic Insert: Recoded E. coli with all UAG codons and RF1 removed (UAG termination abolished); decreased mutation rate; 37C growth tolerated
Vector Backbone Description: Vector Backbone:E. coli genome; Vector Types:Bacterial Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:24136966
Comments: E. coli MG1655 Delta(ybhB-bioAB)::zeoR Delta prfA; all 321 UAG codons changed to UAA This strain is mutS+, which causes a normal spontaneous mutation frequency of ~1E-10. This strain is auxotrophic for d-biotin. The genome sequence of a similar strain (C321.deltaA) was deposited at NCBI (accession # CP006698.1).

Proper citation: RRID:Addgene_49018 Copy   


  • RRID:Addgene_62356

http://www.addgene.org/62356

Species: Viruses (Polyomaviridae)
Genetic Insert: Full genome of BoPyV2a isolate S22
Vector Backbone Description: Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:25568187
Comments: Genome can be liberated by digestion with SacII

Proper citation: RRID:Addgene_62356 Copy   


  • RRID:Addgene_62368

http://www.addgene.org/62368

Species: Viruses (Polyomaviridae)
Genetic Insert: Full genome of BoPyV3 isolate S22
Vector Backbone Description: Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:25568187
Comments: Genome can be liberated by digestion with EcoRI

Proper citation: RRID:Addgene_62368 Copy   


  • RRID:Addgene_62369

http://www.addgene.org/62369

Species: Viruses (Polyomaviridae)
Genetic Insert: Full genome of BoPyV3 isolate S23
Vector Backbone Description: Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:25568187
Comments: Genome can be liberated by digestion with EcoRI

Proper citation: RRID:Addgene_62369 Copy   


  • RRID:Addgene_114269

http://www.addgene.org/114269

Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29986052
Comments: See Supplemental Documents for strain verification protocols and data.

Proper citation: RRID:Addgene_114269 Copy   


  • RRID:Addgene_114268

http://www.addgene.org/114268

Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29986052
Comments: See Supplemental Documents for strain verification protocols and data.

Proper citation: RRID:Addgene_114268 Copy   


  • RRID:Addgene_173852

http://www.addgene.org/173852

Species: Homo sapiens
Genetic Insert: PLD4
Vector Backbone Description: Backbone Marker:Nemazee lab (Deli); Backbone Size:2000; Vector Backbone:SuExp; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:34620855

Proper citation: RRID:Addgene_173852 Copy   


  • RRID:Addgene_173851

http://www.addgene.org/173851

Species: Homo sapiens
Genetic Insert: PLD3
Vector Backbone Description: Backbone Marker:Nemazee lab (Deli); Backbone Size:2000; Vector Backbone:SuExp; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:34620855

Proper citation: RRID:Addgene_173851 Copy   


  • RRID:Addgene_17449

    This resource has 10+ mentions.

http://www.addgene.org/17449

Genetic Insert: GFP
Vector Backbone Description: Backbone Size:5728; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:19657394

Proper citation: RRID:Addgene_17449 Copy   


  • RRID:Addgene_159762

http://www.addgene.org/159762

Species: Homo sapiens
Genetic Insert: ACE2
Vector Backbone Description: Vector Backbone:pFUSE; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:33093202
Comments: Please visit https://doi.org/10.1101/2020.07.31.231746 for bioRxiv preprint.

Proper citation: RRID:Addgene_159762 Copy   


  • RRID:Addgene_160392

    This resource has 1+ mentions.

http://www.addgene.org/160392

Species: wheat
Genetic Insert: wheat GRF4-GIF1 chimera
Vector Backbone Description: Backbone Size:2076; Vector Backbone:pDONR-zeo; Vector Types:Entry clon; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:33046875

Proper citation: RRID:Addgene_160392 Copy   


  • RRID:Addgene_160395

http://www.addgene.org/160395

Species: Vitis
Genetic Insert: Vitis miR396-resistant GRF4-GIF1 chimera
Vector Backbone Description: Backbone Size:2076; Vector Backbone:pDONR-zeo; Vector Types:Entry clon; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:33046875

Proper citation: RRID:Addgene_160395 Copy   


  • RRID:Addgene_160426

http://www.addgene.org/160426

Species: Maristella sp. SVU
Genetic Insert: luciferase
Vector Backbone Description: Backbone Marker:Thermo Fisher; Backbone Size:3600; Vector Backbone:pPICZ-alphaC; Vector Types:Yeast Expression, Luciferase; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:33031624
Comments: Please note: Plasmid contains a 39bp deletion that removes the N-terminal amino acids AQDCYEFTLEKRE from the luciferase compared to the depositor's insert sequence. It is not known how this discrepancy affects the plasmid function, though the plasmid was functional in the depositor's experiments.

Proper citation: RRID:Addgene_160426 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. SPARC Anatomical Working Group Resources

    Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within SPARC SAWG that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X