Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: hGH
Vector Backbone Description: Vector Backbone:PP117; Vector Types:; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29311542
Proper citation: RRID:Addgene_104945 Copy
Genetic Insert: G-CSF
Vector Backbone Description: Vector Backbone:PP117; Vector Types:; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29311542
Proper citation: RRID:Addgene_104944 Copy
Genetic Insert: GFP, mCherry, and CFP
Vector Backbone Description: Vector Backbone:PP117; Vector Types:; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29311542
Proper citation: RRID:Addgene_104952 Copy
Species: Mus musculus
Genetic Insert: IgG1 heavy chain, IgG3 heavy chain
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4483; Vector Backbone:pFUSEss-CHIg-mG1 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29875771
Proper citation: RRID:Addgene_105851 Copy
Species: Mus musculus
Genetic Insert: IgG1 heavy chain
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4474; Vector Backbone:pFUSEss-CHIg-mG1 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29875771
Proper citation: RRID:Addgene_105852 Copy
Species: Mus musculus
Genetic Insert: IgG1 heavy chain, IgG3 heavy chain
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4483; Vector Backbone:pFUSEss-CHIg-mG1 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29875771
Proper citation: RRID:Addgene_105850 Copy
Species: Mus musculus
Genetic Insert: IgG3 heavy chain
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4483; Vector Backbone:pFUSEss-CHIg-mG3 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29875771
Proper citation: RRID:Addgene_105858 Copy
Species: Mus musculus
Genetic Insert: IgG1, IgG3
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4474; Vector Backbone:pFUSEss-CHIg-mG3 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29875771
Proper citation: RRID:Addgene_105856 Copy
Species: Mus musculus
Genetic Insert: IgG1 heavy chain, IgG3 heavy chain
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4483; Vector Backbone:pFUSEss-CHIg-mG1 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29875771
Proper citation: RRID:Addgene_105854 Copy
Species: Mus musculus
Genetic Insert: IgG3 heavy chain
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4483; Vector Backbone:pFUSEss-CHIg-mG3; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29875771
Proper citation: RRID:Addgene_105862 Copy
Species: Mus musculus
Genetic Insert: IgG3 F(ab')2
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4549; Vector Backbone:pFUSEss-CHIg-mG3 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29875771
Proper citation: RRID:Addgene_105860 Copy
Species: Mus musculus
Genetic Insert: IgG1 heavy chain
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4474; Vector Backbone:pFUSEss-CHIg-mG1; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29875771
Proper citation: RRID:Addgene_105849 Copy
Species: Aequorea victoria
Genetic Insert: GFP
Vector Backbone Description: Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:15709003
Proper citation: RRID:Addgene_37329 Copy
Species: Homo sapiens
Genetic Insert: p21
Vector Backbone Description: Backbone Marker:Invivogen; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:23299246
Proper citation: RRID:Addgene_42623 Copy
Species: Mus musculus
Genetic Insert: eIF2beta
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3500; Vector Backbone:pZeoSV2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:11959995
Comments: Two fragments were PCR amplified from GST-eIF2beta (Addgene plasmid 45900) and ligated together with vector to incorporate deletion. Xba1 site is used to ligate the 2 parts of eIF2beta.
Proper citation: RRID:Addgene_45899 Copy
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:4871; Vector Backbone:pPICZalpha C; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:23410102
Comments: C-terminal tags are separated by stop codons. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene.
Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer:
LP1 forward vector primer:
SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3'
LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest:
none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3'
10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3'
StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3'
S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3'
HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3'
Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3'
Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.
Proper citation: RRID:Addgene_55190 Copy
Species: Synthetic
Genetic Insert: TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:24076762
Proper citation: RRID:Addgene_48677 Copy
Species: Discosoma sp
Genetic Insert: dsRed-Express
Vector Backbone Description: Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:17603495
Comments: This plasmid is nearly identical to pRwB (http://www.addgene.org/48734), except that it contains a 2kb stuffer region to bring its size closer to the ~8kb native papillomavirus genome. For more information on using this plasmid, please see the following website: http://home.ccr.cancer.gov/Lco/target.htm
Proper citation: RRID:Addgene_48733 Copy
Species: Discosoma sp
Genetic Insert: dsRed-Express
Vector Backbone Description: Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:19073722
Comments: Note that this plasmid is substantially smaller than the ~8kb native papillomavirus genome. There is a second version of this plasmid with a 2kb stuffer region that is available here: http://www.addgene.org/48733 . Further information can be found here: http://home.ccr.cancer.gov/Lco/target.htm
Proper citation: RRID:Addgene_48734 Copy
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29986052
Comments: See Supplemental Documents for strain verification protocols and data.
Proper citation: RRID:Addgene_114269 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within SPARC SAWG that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
