Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 7 showing 121 ~ 140 out of 4,489 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/24044

Species: Saccharomyces cerevisiae
Genetic Insert: PHO4
Vector Backbone Description: Backbone Size:9000; Vector Backbone:pYX242; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: NLS of PHO4 (bp 421-588) inserted in EcoRI/BamHI, eGFP inserted downstream in BamHI/HindIII and a single PrA repeat inserted further downstream in HindIII/SalI of pYX242. PrA motif sequence downstream of GFP: GCTCAACAAAATGCTTTTTATCAAGTCTTAAATATGCCTAACTTAAATGCTGATCAACGCAATGGTTTTATCCAAAGCCTTAAAGATGATCCAAGCCAAAGTGCTAACGTTTTAGGTGAAGCTCAAAAACTTAATGACTCTCAAGCTCCAAAAGCTGATGCGCAACAAAATAAC

Proper citation: RRID:Addgene_24044 Copy   


  • RRID:Addgene_24045

http://www.addgene.org/24045

Species: Saccharomyces cerevisiae
Genetic Insert: KAP95
Vector Backbone Description: Backbone Marker:Rosemary Williams (Rout Lab); Backbone Size:7100; Vector Backbone:pYEX-U (modified pYEX-BX); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: KAP95 fused upstream of two FLU tags in BamHI/SalI of pBT024

Proper citation: RRID:Addgene_24045 Copy   


  • RRID:Addgene_17418

http://www.addgene.org/17418

Species: Saccharomyces cerevisiae
Genetic Insert: GALL promoter + polylinker + CYC1 terminator
Vector Backbone Description: Backbone Size:2574; Vector Backbone:p404ADH1; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Comments: Mumberg D, Muller R, Funk M. Nucleic Acids Res. 25:5767-8 (1994).

Proper citation: RRID:Addgene_17418 Copy   


  • RRID:Addgene_17419

http://www.addgene.org/17419

Species: Saccharomyces cerevisiae
Genetic Insert: MET3 promoter + polylinker + CYC1 terminator
Vector Backbone Description: Backbone Size:2581; Vector Backbone:p404ADH1; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_17419 Copy   


  • RRID:Addgene_17437

http://www.addgene.org/17437

Species: Saccharomyces cerevisiae
Genetic Insert: GAL1 promoter + polylinker + CYC1 terminator
Vector Backbone Description: Backbone Marker:Sikorski & Hieter, Genetics 122:19-27 (1989); Backbone Size:2691; Vector Backbone:pRS406; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Comments: Mumberg D, Muller R, Funk M. Nucleic Acids Res. 25:5767-8 (1994).

Proper citation: RRID:Addgene_17437 Copy   


  • RRID:Addgene_174830

http://www.addgene.org/174830

Species: Saccharomyces cerevisiae
Genetic Insert: 11R Unique
Vector Backbone Description: Backbone Marker:ThermoFisher; Backbone Size:3956; Vector Backbone:pCR2.1-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34702734

Proper citation: RRID:Addgene_174830 Copy   


  • RRID:Addgene_174888

http://www.addgene.org/174888

Species: Saccharomyces cerevisiae
Genetic Insert: Met4 UIML
Vector Backbone Description: Vector Backbone:pet28(a); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34763062

Proper citation: RRID:Addgene_174888 Copy   


  • RRID:Addgene_175418

http://www.addgene.org/175418

Species: Saccharomyces cerevisiae
Genetic Insert: eRF3
Vector Backbone Description: Backbone Marker:UC Berkeley MacroLab; Vector Backbone:1C; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34413231

Proper citation: RRID:Addgene_175418 Copy   


  • RRID:Addgene_176177

http://www.addgene.org/176177

Species: Saccharomyces cerevisiae
Genetic Insert: 3' homology for integration site XII-5
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34860007
Comments: Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). Homologous region amplified from EasyClone-MarkerFree toolkit (Jessop-Fabre et al. Biotechnol J. 2016).

Proper citation: RRID:Addgene_176177 Copy   


  • RRID:Addgene_176179

http://www.addgene.org/176179

Species: Saccharomyces cerevisiae
Genetic Insert: dropout cassette containing toxic genes ccdB and TPK2
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34860007
Comments: Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015).

Proper citation: RRID:Addgene_176179 Copy   


  • RRID:Addgene_176170

http://www.addgene.org/176170

Species: Saccharomyces cerevisiae
Genetic Insert: 5' homology for integration site XI-3
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34860007
Comments: Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). Homologous region amplified from EasyClone-MarkerFree toolkit (Jessop-Fabre et al. Biotechnol J. 2016).

Proper citation: RRID:Addgene_176170 Copy   


  • RRID:Addgene_176172

http://www.addgene.org/176172

Species: Saccharomyces cerevisiae
Genetic Insert: 5' homology for integration site XI-5
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34860007
Comments: Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). Homologous region amplified from EasyClone-MarkerFree toolkit (Jessop-Fabre et al. Biotechnol J. 2016).

Proper citation: RRID:Addgene_176172 Copy   


  • RRID:Addgene_176175

http://www.addgene.org/176175

Species: Saccharomyces cerevisiae
Genetic Insert: 3' homology for integration site XII-2
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34860007
Comments: Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). Homologous region amplified from EasyClone-MarkerFree toolkit (Jessop-Fabre et al. Biotechnol J. 2016).

Proper citation: RRID:Addgene_176175 Copy   


  • RRID:Addgene_176174

http://www.addgene.org/176174

Species: Saccharomyces cerevisiae
Genetic Insert: 5' homology for integration site XII-2
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34860007
Comments: Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). Homologous region amplified from EasyClone-MarkerFree toolkit (Jessop-Fabre et al. Biotechnol J. 2016).

Proper citation: RRID:Addgene_176174 Copy   


  • RRID:Addgene_176166

http://www.addgene.org/176166

Species: Saccharomyces cerevisiae
Genetic Insert: 5' homology for integration site XI-1
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34860007
Comments: Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). Homologous region amplified from EasyClone-MarkerFree toolkit (Jessop-Fabre et al. Biotechnol J. 2016).

Proper citation: RRID:Addgene_176166 Copy   


  • RRID:Addgene_20156

    This resource has 1+ mentions.

http://www.addgene.org/20156

Species: Saccharomyces cerevisiae
Genetic Insert: CFP-FKBP-Inp54p (D281A)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:ECFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16990515

Proper citation: RRID:Addgene_20156 Copy   


  • RRID:Addgene_20368

    This resource has 1+ mentions.

http://www.addgene.org/20368

Species: Saccharomyces cerevisiae
Genetic Insert: SUMO-conjugating enzyme Ubc9
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:6600; Vector Backbone:pESC-URA; Vector Types:Yeast Expression, yeast/bacteria shuttle; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18756251

Proper citation: RRID:Addgene_20368 Copy   


  • RRID:Addgene_31130

    This resource has 1+ mentions.

http://www.addgene.org/31130

Species: Saccharomyces cerevisiae
Genetic Insert: FLP recombinase
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11376165

Proper citation: RRID:Addgene_31130 Copy   


  • RRID:Addgene_32159

http://www.addgene.org/32159

Species: Saccharomyces cerevisiae
Genetic Insert: PAN1
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: PAN1-HA including 1kB upstream sequence and 280bp downstream sequence of PAN1 ORF.

Proper citation: RRID:Addgene_32159 Copy   


  • RRID:Addgene_32158

http://www.addgene.org/32158

Species: Saccharomyces cerevisiae
Genetic Insert: STE2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_32158 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. SPARC Anatomical Working Group Resources

    Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within SPARC SAWG that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X