Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:saccharomyces cerevisiae (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

4,489 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
PHO4NLS-GFP-PRA (109)
 
Resource Report
Resource Website 		RRID:Addgene_24044 PHO4 Saccharomyces cerevisiae Ampicillin NLS of PHO4 (bp 421-588) inserted in EcoRI/BamHI, eGFP inserted downstream in BamHI/HindIII and a single PrA repeat inserted further downstream in HindIII/SalI of pYX242. PrA motif sequence downstream of GFP: GCTCAACAAAATGCTTTTTATCAAGTCTTAAATATGCCTAACTTAAATGCTGATCAACGCAATGGTTTTATCCAAAGCCTTAAAGATGATCCAAGCCAAAGTGCTAACGTTTTAGGTGAAGCTCAAAAACTTAATGACTCTCAAGCTCCAAAAGCTGATGCGCAACAAAATAAC Backbone Size:9000; Vector Backbone:pYX242; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Only bp 421-588 of PHO4 (NLS) 2026-09-01 09:47:20 0
KAP95-FLU (113)
 
Resource Report
Resource Website 		RRID:Addgene_24045 KAP95 Saccharomyces cerevisiae Ampicillin KAP95 fused upstream of two FLU tags in BamHI/SalI of pBT024 Backbone Marker:Rosemary Williams (Rout Lab); Backbone Size:7100; Vector Backbone:pYEX-U (modified pYEX-BX); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:47:21 0
p404GALL
 
Resource Report
Resource Website 		RRID:Addgene_17418 GALL promoter + polylinker + CYC1 terminator Saccharomyces cerevisiae Ampicillin Mumberg D, Muller R, Funk M. Nucleic Acids Res. 25:5767-8 (1994). Backbone Size:2574; Vector Backbone:p404ADH1; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin GALL promoter is between SacI and XbaI restriction sites. 2026-09-01 09:29:21 0
p404MET3
 
Resource Report
Resource Website 		RRID:Addgene_17419 MET3 promoter + polylinker + CYC1 terminator Saccharomyces cerevisiae Ampicillin Backbone Size:2581; Vector Backbone:p404ADH1; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin MET3 promoter is between SacI and XbaI restriction sites. 2026-09-01 09:29:21 0
p406GAL1
 
Resource Report
Resource Website 		RRID:Addgene_17437 GAL1 promoter + polylinker + CYC1 terminator Saccharomyces cerevisiae Ampicillin Mumberg D, Muller R, Funk M. Nucleic Acids Res. 25:5767-8 (1994). Backbone Marker:Sikorski & Hieter, Genetics 122:19-27 (1989); Backbone Size:2691; Vector Backbone:pRS406; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin GAL1 promoter is between SacI and XbaI restriction sites. 2026-09-01 09:29:24 0
pCS105
 
Resource Report
Resource Website 		RRID:Addgene_174830 11R Unique Saccharomyces cerevisiae Ampicillin PMID:34702734 Backbone Marker:ThermoFisher; Backbone Size:3956; Vector Backbone:pCR2.1-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Changing TEL11R to a unique end 2026-09-01 09:29:32 0
UIMLx2
 
Resource Report
Resource Website 		RRID:Addgene_174888 Met4 UIML Saccharomyces cerevisiae Kanamycin PMID:34763062 Vector Backbone:pet28(a); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-09-01 09:29:33 0
Sc eRF3∆165N (WT)
 
Resource Report
Resource Website 		RRID:Addgene_175418 eRF3 Saccharomyces cerevisiae Kanamycin PMID:34413231 Backbone Marker:UC Berkeley MacroLab; Vector Backbone:1C; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin ∆165N 2026-09-01 09:29:42 0
pMC7-XII5dw
 
Resource Report
Resource Website 		RRID:Addgene_176177 3' homology for integration site XII-5 Saccharomyces cerevisiae Chloramphenicol PMID:34860007 Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). Homologous region amplified from EasyClone-MarkerFree toolkit (Jessop-Fabre et al. Biotechnol J. 2016). Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol 2026-09-01 09:29:53 0
pMC234r-ccdB/TPK2
 
Resource Report
Resource Website 		RRID:Addgene_176179 dropout cassette containing toxic genes ccdB and TPK2 Saccharomyces cerevisiae Chloramphenicol PMID:34860007 Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol 2026-09-01 09:29:53 0
pMC8b-XI3up
 
Resource Report
Resource Website 		RRID:Addgene_176170 5' homology for integration site XI-3 Saccharomyces cerevisiae Chloramphenicol PMID:34860007 Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). Homologous region amplified from EasyClone-MarkerFree toolkit (Jessop-Fabre et al. Biotechnol J. 2016). Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol 2026-09-01 09:29:53 0
pMC8b-XI5up
 
Resource Report
Resource Website 		RRID:Addgene_176172 5' homology for integration site XI-5 Saccharomyces cerevisiae Chloramphenicol PMID:34860007 Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). Homologous region amplified from EasyClone-MarkerFree toolkit (Jessop-Fabre et al. Biotechnol J. 2016). Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol 2026-09-01 09:29:53 0
pMC7-XII2dw
 
Resource Report
Resource Website 		RRID:Addgene_176175 3' homology for integration site XII-2 Saccharomyces cerevisiae Chloramphenicol PMID:34860007 Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). Homologous region amplified from EasyClone-MarkerFree toolkit (Jessop-Fabre et al. Biotechnol J. 2016). Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol 2026-09-01 09:29:53 0
pMC8b-XII2up
 
Resource Report
Resource Website 		RRID:Addgene_176174 5' homology for integration site XII-2 Saccharomyces cerevisiae Chloramphenicol PMID:34860007 Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). Homologous region amplified from EasyClone-MarkerFree toolkit (Jessop-Fabre et al. Biotechnol J. 2016). Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol 2026-09-01 09:29:53 0
pMC8b-XI1up
 
Resource Report
Resource Website 		RRID:Addgene_176166 5' homology for integration site XI-1 Saccharomyces cerevisiae Chloramphenicol PMID:34860007 Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). Homologous region amplified from EasyClone-MarkerFree toolkit (Jessop-Fabre et al. Biotechnol J. 2016). Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol 2026-09-01 09:29:53 0
CF-Inp(D281A)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_20156 CFP-FKBP-Inp54p (D281A) Saccharomyces cerevisiae Kanamycin PMID:16990515 Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:ECFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Stop codon at position 331. D281A mutation. 2026-09-01 09:36:29 4
pESC-URA-GFP-Ubc9wt
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_20368 SUMO-conjugating enzyme Ubc9 Saccharomyces cerevisiae Ampicillin PMID:18756251 Backbone Marker:Stratagene; Backbone Size:6600; Vector Backbone:pESC-URA; Vector Types:Yeast Expression, yeast/bacteria shuttle; Bacterial Resistance:Ampicillin 2026-09-01 09:37:03 2
pCSFLPe
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31130 FLP recombinase Saccharomyces cerevisiae Ampicillin PMID:11376165 Backbone Size:4100; Vector Backbone:pCS2+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:52:32 2
LHP416-PAN1-HA
 
Resource Report
Resource Website 		RRID:Addgene_32159 PAN1 Saccharomyces cerevisiae Ampicillin PAN1-HA including 1kB upstream sequence and 280bp downstream sequence of PAN1 ORF. Vector Backbone:Unknown; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:52:46 0
LHP334-pcDNA3-STE2
 
Resource Report
Resource Website 		RRID:Addgene_32158 STE2 Saccharomyces cerevisiae Ampicillin Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:52:46 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. SPARC Anatomical Working Group Resources

    Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The Stimulating Peripheral Activity to Relieve Conditions (SPARC) effort is the result of National Institutes of Health’s (NIH) drive to map out the neural circuitry responsible for visceral control in higher vertebrates. The SPARC Anatomy Working Group (SAWG) is responsible for the integrity of anatomical knowledge in SPARC

Recent News Entries

Contact Us

Maryann Martone, Ph.D.

Department of Neurosciences, School of Medicine

University of California, San Diego

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch