Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
https://dgrc.bio.indiana.edu/stock/6189
Species: Drosophila melanogaster
Genetic Insert: arm
Defining Citation: PMID:12176937
Comments: BDGP ESTs,BDGP Gold cDNAs,BDGP DGC Release 1
Proper citation: RRID:DGRC_6189 Copy
https://dgrc.bio.indiana.edu/stock/1663924
Species: Drosophila melanogaster
Genetic Insert: HDAC6
Comments: BDGP Tagged ORF Collection
Proper citation: RRID:DGRC_1663924 Copy
https://dgrc.bio.indiana.edu/stock/1643419
Species: Drosophila melanogaster
Genetic Insert: Papss
Comments: BDGP Tagged ORF Collection
Proper citation: RRID:DGRC_1643419 Copy
https://dgrc.bio.indiana.edu/stock/1064136
Species: Drosophila melanogaster
Genetic Insert: CG1667
Defining Citation: PMID:12176937
Comments: BDGP DGC Release 3,BDGP Gold cDNAs,BDGP ESTs
Proper citation: RRID:DGRC_1064136 Copy
https://dgrc.bio.indiana.edu/stock/9148
Species: Drosophila melanogaster
Genetic Insert: CG5059
Defining Citation: PMID:12176937
Comments: BDGP DGC Release 2,BDGP ESTs,BDGP Gold cDNAs
Proper citation: RRID:DGRC_9148 Copy
https://dgrc.bio.indiana.edu/stock/2361
Species: Drosophila melanogaster
Genetic Insert: hb
Defining Citation: PMID:12176937
Comments: BDGP DGC Release 1,BDGP ESTs
Proper citation: RRID:DGRC_2361 Copy
https://dgrc.bio.indiana.edu/stock/4205
Species: Drosophila melanogaster
Genetic Insert: Syx13
Defining Citation: PMID:12176937
Comments: BDGP ESTs,BDGP Gold cDNAs,BDGP DGC Release 1
Proper citation: RRID:DGRC_4205 Copy
https://dgrc.bio.indiana.edu/stock/8454
Species: Drosophila melanogaster
Genetic Insert: Mlp60A
Defining Citation: PMID:12176937
Comments: BDGP DGC Release 2,BDGP ESTs
Proper citation: RRID:DGRC_8454 Copy
https://dgrc.bio.indiana.edu/stock/1621050
Species: Drosophila melanogaster
Genetic Insert: Ama
Comments: BDGP Tagged ORF Collection
Proper citation: RRID:DGRC_1621050 Copy
https://dgrc.bio.indiana.edu/stock/1613078
Species: Drosophila melanogaster
Genetic Insert: eIF-2alpha
Comments: BDGP Tagged ORF Collection
Proper citation: RRID:DGRC_1613078 Copy
https://dgrc.bio.indiana.edu/stock/1263019
Species: Drosophila melanogaster
Genetic Insert: kek1
Defining Citation: PMID:12176937
Comments: BDGP ESTs,BDGP Gold cDNAs
Proper citation: RRID:DGRC_1263019 Copy
https://dgrc.bio.indiana.edu/stock/6307
Species: Drosophila melanogaster
Genetic Insert: CG6758
Defining Citation: PMID:12176937
Comments: BDGP Gold cDNAs,BDGP ESTs,BDGP DGC Release 1
Proper citation: RRID:DGRC_6307 Copy
https://dgrc.bio.indiana.edu/stock/1135960
Species: Drosophila melanogaster
Genetic Insert: ich
Defining Citation: PMID:12176937
Comments: BDGP ESTs
Proper citation: RRID:DGRC_1135960 Copy
https://dgrc.bio.indiana.edu/stock/8512
Species: Drosophila melanogaster
Genetic Insert: pgc
Defining Citation: PMID:12176937
Comments: BDGP ESTs,BDGP DGC Release 2,BDGP Gold cDNAs
Proper citation: RRID:DGRC_8512 Copy
https://dgrc.bio.indiana.edu/stock/12679
Species: Drosophila melanogaster
Defining Citation: PMID:12176937
Comments: BDGP ESTs,BDGP DGC Release 2
Proper citation: RRID:DGRC_12679 Copy
https://dgrc.bio.indiana.edu/stock/9242
Species: Drosophila melanogaster
Genetic Insert: h
Defining Citation: PMID:12176937
Comments: BDGP ESTs,BDGP Gold cDNAs,BDGP DGC Release 2
Proper citation: RRID:DGRC_9242 Copy
https://dgrc.bio.indiana.edu/stock/1333567
Species: Drosophila melanogaster
Genetic Insert: Dad
Defining Citation: PMID:12176937
Comments: BDGP Gold cDNAs,BDGP DGC Release 3,BDGP ESTs
Proper citation: RRID:DGRC_1333567 Copy
https://dgrc.bio.indiana.edu/stock/2235
Species: Drosophila melanogaster
Genetic Insert: mbo
Defining Citation: PMID:12176937
Comments: BDGP ESTs,BDGP DGC Release 1,BDGP Gold cDNAs
Proper citation: RRID:DGRC_2235 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-126-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103192 Copy
Species: Other
Genetic Insert: Q73QW6(Cas9 coding gene from Streptococcus mutans serotype c (strain ATCC 700610 / UA159))
Vector Backbone Description: Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29529247
Proper citation: RRID:Addgene_103130 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within SPARC SAWG that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.