Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 7 showing 121 ~ 140 out of 32,424 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:DGRC_6189

    This resource has 1+ mentions.

https://dgrc.bio.indiana.edu/stock/6189

Species: Drosophila melanogaster
Genetic Insert: arm
Defining Citation: PMID:12176937
Comments: BDGP ESTs,BDGP Gold cDNAs,BDGP DGC Release 1

Proper citation: RRID:DGRC_6189 Copy   


  • RRID:DGRC_1663924

    This resource has 1+ mentions.

https://dgrc.bio.indiana.edu/stock/1663924

Species: Drosophila melanogaster
Genetic Insert: HDAC6
Comments: BDGP Tagged ORF Collection

Proper citation: RRID:DGRC_1663924 Copy   


  • RRID:DGRC_1643419

    This resource has 1+ mentions.

https://dgrc.bio.indiana.edu/stock/1643419

Species: Drosophila melanogaster
Genetic Insert: Papss
Comments: BDGP Tagged ORF Collection

Proper citation: RRID:DGRC_1643419 Copy   


  • RRID:DGRC_1064136

    This resource has 1+ mentions.

https://dgrc.bio.indiana.edu/stock/1064136

Species: Drosophila melanogaster
Genetic Insert: CG1667
Defining Citation: PMID:12176937
Comments: BDGP DGC Release 3,BDGP Gold cDNAs,BDGP ESTs

Proper citation: RRID:DGRC_1064136 Copy   


  • RRID:DGRC_9148

    This resource has 1+ mentions.

https://dgrc.bio.indiana.edu/stock/9148

Species: Drosophila melanogaster
Genetic Insert: CG5059
Defining Citation: PMID:12176937
Comments: BDGP DGC Release 2,BDGP ESTs,BDGP Gold cDNAs

Proper citation: RRID:DGRC_9148 Copy   


  • RRID:DGRC_2361

    This resource has 1+ mentions.

https://dgrc.bio.indiana.edu/stock/2361

Species: Drosophila melanogaster
Genetic Insert: hb
Defining Citation: PMID:12176937
Comments: BDGP DGC Release 1,BDGP ESTs

Proper citation: RRID:DGRC_2361 Copy   


  • RRID:DGRC_4205

    This resource has 1+ mentions.

https://dgrc.bio.indiana.edu/stock/4205

Species: Drosophila melanogaster
Genetic Insert: Syx13
Defining Citation: PMID:12176937
Comments: BDGP ESTs,BDGP Gold cDNAs,BDGP DGC Release 1

Proper citation: RRID:DGRC_4205 Copy   


  • RRID:DGRC_8454

    This resource has 1+ mentions.

https://dgrc.bio.indiana.edu/stock/8454

Species: Drosophila melanogaster
Genetic Insert: Mlp60A
Defining Citation: PMID:12176937
Comments: BDGP DGC Release 2,BDGP ESTs

Proper citation: RRID:DGRC_8454 Copy   


  • RRID:DGRC_1621050

    This resource has 1+ mentions.

https://dgrc.bio.indiana.edu/stock/1621050

Species: Drosophila melanogaster
Genetic Insert: Ama
Comments: BDGP Tagged ORF Collection

Proper citation: RRID:DGRC_1621050 Copy   


  • RRID:DGRC_1613078

    This resource has 1+ mentions.

https://dgrc.bio.indiana.edu/stock/1613078

Species: Drosophila melanogaster
Genetic Insert: eIF-2alpha
Comments: BDGP Tagged ORF Collection

Proper citation: RRID:DGRC_1613078 Copy   


  • RRID:DGRC_1263019

    This resource has 1+ mentions.

https://dgrc.bio.indiana.edu/stock/1263019

Species: Drosophila melanogaster
Genetic Insert: kek1
Defining Citation: PMID:12176937
Comments: BDGP ESTs,BDGP Gold cDNAs

Proper citation: RRID:DGRC_1263019 Copy   


  • RRID:DGRC_6307

    This resource has 1+ mentions.

https://dgrc.bio.indiana.edu/stock/6307

Species: Drosophila melanogaster
Genetic Insert: CG6758
Defining Citation: PMID:12176937
Comments: BDGP Gold cDNAs,BDGP ESTs,BDGP DGC Release 1

Proper citation: RRID:DGRC_6307 Copy   


  • RRID:DGRC_1135960

    This resource has 1+ mentions.

https://dgrc.bio.indiana.edu/stock/1135960

Species: Drosophila melanogaster
Genetic Insert: ich
Defining Citation: PMID:12176937
Comments: BDGP ESTs

Proper citation: RRID:DGRC_1135960 Copy   


  • RRID:DGRC_8512

    This resource has 1+ mentions.

https://dgrc.bio.indiana.edu/stock/8512

Species: Drosophila melanogaster
Genetic Insert: pgc
Defining Citation: PMID:12176937
Comments: BDGP ESTs,BDGP DGC Release 2,BDGP Gold cDNAs

Proper citation: RRID:DGRC_8512 Copy   


  • RRID:DGRC_12679

    This resource has 1+ mentions.

https://dgrc.bio.indiana.edu/stock/12679

Species: Drosophila melanogaster
Defining Citation: PMID:12176937
Comments: BDGP ESTs,BDGP DGC Release 2

Proper citation: RRID:DGRC_12679 Copy   


  • RRID:DGRC_9242

    This resource has 1+ mentions.

https://dgrc.bio.indiana.edu/stock/9242

Species: Drosophila melanogaster
Genetic Insert: h
Defining Citation: PMID:12176937
Comments: BDGP ESTs,BDGP Gold cDNAs,BDGP DGC Release 2

Proper citation: RRID:DGRC_9242 Copy   


  • RRID:DGRC_1333567

    This resource has 1+ mentions.

https://dgrc.bio.indiana.edu/stock/1333567

Species: Drosophila melanogaster
Genetic Insert: Dad
Defining Citation: PMID:12176937
Comments: BDGP Gold cDNAs,BDGP DGC Release 3,BDGP ESTs

Proper citation: RRID:DGRC_1333567 Copy   


  • RRID:DGRC_2235

    This resource has 1+ mentions.

https://dgrc.bio.indiana.edu/stock/2235

Species: Drosophila melanogaster
Genetic Insert: mbo
Defining Citation: PMID:12176937
Comments: BDGP ESTs,BDGP DGC Release 1,BDGP Gold cDNAs

Proper citation: RRID:DGRC_2235 Copy   


  • RRID:Addgene_103192

    This resource has 1+ mentions.

http://www.addgene.org/103192

Species: Homo sapiens
Genetic Insert: hsa-miR-126-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103192 Copy   


  • RRID:Addgene_103130

    This resource has 50+ mentions.

http://www.addgene.org/103130

Species: Other
Genetic Insert: Q73QW6(Cas9 coding gene from Streptococcus mutans serotype c (strain ATCC 700610 / UA159))
Vector Backbone Description: Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29529247

Proper citation: RRID:Addgene_103130 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. SPARC Anatomical Working Group Resources

    Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within SPARC SAWG that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X