Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 6 showing 101 ~ 120 out of 742,581 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_103140

http://www.addgene.org/103140

Species: Saccharomyces cerevisiae
Genetic Insert: dCas9-VPR
Vector Backbone Description: Vector Backbone:pDTU-113; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29161506

Proper citation: RRID:Addgene_103140 Copy   


http://www.addgene.org/103142

Species: Geminigera cryophila
Genetic Insert: Anion channelrhodopsin GcACR_439
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6217; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28256618

Proper citation: RRID:Addgene_103142 Copy   


  • RRID:Addgene_103141

http://www.addgene.org/103141

Species: Saccharomyces cerevisiae
Genetic Insert: gRNAs
Vector Backbone Description: Vector Backbone:dCas9v2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29161506

Proper citation: RRID:Addgene_103141 Copy   


  • RRID:Addgene_103231

http://www.addgene.org/103231

Species: Homo sapiens
Genetic Insert: hsa-miR-136-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103231 Copy   


  • RRID:Addgene_103234

http://www.addgene.org/103234

Species: Homo sapiens
Genetic Insert: hsa-miR-139-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103234 Copy   


  • RRID:Addgene_103233

http://www.addgene.org/103233

Species: Homo sapiens
Genetic Insert: hsa-miR-138-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103233 Copy   


  • RRID:Addgene_103197

http://www.addgene.org/103197

Species: Homo sapiens
Genetic Insert: hsa-miR-1278 target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103197 Copy   


  • RRID:Addgene_103238

http://www.addgene.org/103238

Species: Homo sapiens
Genetic Insert: hsa-miR-141-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103238 Copy   


  • RRID:Addgene_103237

http://www.addgene.org/103237

Species: Homo sapiens
Genetic Insert: hsa-miR-140-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103237 Copy   


  • RRID:Addgene_103245

http://www.addgene.org/103245

Species: Homo sapiens
Genetic Insert: hsa-miR-144-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103245 Copy   


  • RRID:Addgene_103244

http://www.addgene.org/103244

Species: Homo sapiens
Genetic Insert: hsa-miR-144-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103244 Copy   


  • RRID:Addgene_103241

http://www.addgene.org/103241

Species: Homo sapiens
Genetic Insert: hsa-miR-142-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103241 Copy   


  • RRID:Addgene_103246

http://www.addgene.org/103246

Species: Homo sapiens
Genetic Insert: hsa-miR-145-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103246 Copy   


  • RRID:Addgene_103210

http://www.addgene.org/103210

Species: Homo sapiens
Genetic Insert: hsa-miR-1304-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103210 Copy   


  • RRID:Addgene_103297

http://www.addgene.org/103297

Species: Homo sapiens
Genetic Insert: hsa-miR-190a-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103297 Copy   


  • RRID:Addgene_103212

http://www.addgene.org/103212

Species: Homo sapiens
Genetic Insert: hsa-miR-1306-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103212 Copy   


  • RRID:Addgene_103294

http://www.addgene.org/103294

Species: Homo sapiens
Genetic Insert: hsa-miR-18b-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103294 Copy   


  • RRID:Addgene_103218

http://www.addgene.org/103218

Species: Homo sapiens
Genetic Insert: hsa-miR-130b-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103218 Copy   


  • RRID:Addgene_103219

    This resource has 1+ mentions.

http://www.addgene.org/103219

Species: Homo sapiens
Genetic Insert: hsa-miR-132-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103219 Copy   


  • RRID:Addgene_103216

http://www.addgene.org/103216

Species: Homo sapiens
Genetic Insert: hsa-miR-130a-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103216 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. SPARC Anatomical Working Group Resources

    Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within SPARC SAWG that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X