Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Panicum virgatum
Genetic Insert: Pv4CL1
Vector Backbone Description: Backbone Size:4111; Vector Backbone:MoClo adapted pGAPZ-vector with hygromycin resistance; Vector Types:Yeast Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:38457503
Proper citation: RRID:Addgene_219768 Copy
Species: Derived from Aequorea victoria.
Genetic Insert: sfGFP
Vector Backbone Description: Vector Backbone:p15A and pWH1266; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:39302127
Comments: Shuttle vector that replicates in A. baumannii and E. coli; replicates in common cloning strains such as DH10B.
Proper citation: RRID:Addgene_222353 Copy
Vector Backbone Description: Vector Backbone:R6Kγ; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:39302127
Comments: Tn7 expression vector.
Proper citation: RRID:Addgene_222357 Copy
Species: Mycobacterium marinum
Genetic Insert: lpqZ
Vector Backbone Description: Backbone Size:5720; Vector Backbone:pSMT3; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:41384969
Proper citation: RRID:Addgene_240159 Copy
Species: Mycobacterium marinum
Genetic Insert: fecB (MMAR_1650)
Vector Backbone Description: Vector Backbone:pSMT3; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:41384969
Proper citation: RRID:Addgene_240158 Copy
Species: Mycobacterium smegmatis MC2-155
Genetic Insert: 3' rpoC(MSMEG_1368)-ALFA
Vector Backbone Description: Vector Backbone:pAJF229; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:40576343
Proper citation: RRID:Addgene_252904 Copy
Species: Escherichia coli
Genetic Insert: Deficient in the P2 bacteriophage packaging cos site; rhamnose-inducible P4 delta (δ) and epsilon (ε) genes
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Hygromycin
Defining Citation: PMID:33317264
Comments: P2 bacteriophage lysogen derived from E. coli EMG C-5545 strain.
We designed a pair of primers to check the presence of P2 lysogen in this strain:
- P2 gpH C-ter gpG Fw: 5’ GCAGAGCACGAACAGTCACG 3’
- P2 gpH C-ter gpG Rv: 5’ TTATTGCGGCATTTCCGGCC 3’
These primers amplify the C-terminal region of the P2 gpH gene (tail fiber) and the complete gpG gene (tail fiber chaperone) (PCR fragment size: 2070 bp).
Proper citation: RRID:Addgene_209018 Copy
Species: Synthetic
Genetic Insert: CRISPRt transposon with gRNA expression cassette (no guide)
Vector Backbone Description: Vector Backbone:R6K_; Vector Types:Bacterial Expression, Synthetic Biology, CRISPR Associated Transposition (CAST); Bacterial Resistance:Hygromycin
Comments: Please visit https://doi.org/10.1101/2024.03.01.582922 for bioRxiv preprint.
Proper citation: RRID:Addgene_225843 Copy
Vector Backbone Description: Backbone Size:3295; Vector Backbone:BB3; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:29221460
Proper citation: RRID:Addgene_98543 Copy
Vector Backbone Description: Backbone Size:3287; Vector Backbone:BB3; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:29221460
Proper citation: RRID:Addgene_98546 Copy
Species: Discosoma sp
Genetic Insert: mCherry
Vector Backbone Description: Backbone Size:5994; Vector Backbone:pMyCA; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:28857325
Proper citation: RRID:Addgene_84272 Copy
Vector Backbone Description: Backbone Size:5994; Vector Backbone:pAL5000, pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:28857325
Proper citation: RRID:Addgene_84268 Copy
Genetic Insert: sgRNA cloning site
Vector Backbone Description: Backbone Marker:Addgene 20318; Backbone Size:6608; Vector Backbone:pTE-10M-0X; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Hygromycin
Defining Citation: PMID:27407107
Proper citation: RRID:Addgene_84380 Copy
Species: Synthetic
Genetic Insert: attR
Vector Backbone Description: Backbone Marker:Aubry C. et al. Appl Environ Mic 2019. Modular and Integrative Vectors for Synthetic Biology Applications in Streptomyces spp; Backbone Size:5835; Vector Backbone:pOSV805; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:35456877
Proper citation: RRID:Addgene_172194 Copy
Species: Synthetic
Genetic Insert: mCherry-NES
Vector Backbone Description: Backbone Marker:InvivoGen; Backbone Size:6491; Vector Backbone:pVITRO1-hygro-mcs; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:34838160
Proper citation: RRID:Addgene_186349 Copy
Species: Synthetic
Genetic Insert: mCherry-LaminB1
Vector Backbone Description: Backbone Marker:InvivoGen; Backbone Size:6491; Vector Backbone:pVITRO1-hygro-mcs; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:34838160
Proper citation: RRID:Addgene_186348 Copy
Vector Backbone Description: Backbone Marker:Sheng Yang Lab; Backbone Size:3500; Vector Backbone:pGHYB; Vector Types:Yeast Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:24822243
Proper citation: RRID:Addgene_87447 Copy
Genetic Insert: hyg
Vector Backbone Description: Backbone Marker:Yale Coli Genetic Stock Center; Backbone Size:6000; Vector Backbone:pCP20; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:24398052
Proper citation: RRID:Addgene_87831 Copy
Species: Other
Genetic Insert: Cas9
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Hygromycin
Defining Citation: PMID:30217854
Proper citation: RRID:Addgene_117232 Copy
Species: M. smegmatis
Genetic Insert: gfp, hyg
Vector Backbone Description: Vector Backbone:pYS2; Vector Types:Deletion generation; Bacterial Resistance:Hygromycin
Defining Citation: PMID:24100088
Comments: Addgene QC Next-generation sequencing identified a sequence discrepancy relative to the Genbank file linked under Supplemental Documents. Plasmid is expected to function as described in the associated publication.
Proper citation: RRID:Addgene_117490 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within SPARC SAWG that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
