Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

742,877 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
Hsh155 Hs 1-5 3xFLAG
 
Resource Report
Resource Website
RRID:Addgene_111963 Hsh155 Hs 1-5 3x FLAG Saccharomyces cerevisiae Ampicillin PMID:29752352 Backbone Marker:ATCC; Backbone Size:5208; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin Human HEATs 1-5 inserted 2026-09-12 02:15:16 0
CD4-C-GFP HDRT Source (pTR 152)
 
Resource Report
Resource Website
RRID:Addgene_112018 CD4-GFP HDRT Homo sapiens Ampicillin PMID:29995861 gRNA sequence that can be used with this DNA template: CTGGCCTCGTGCCTCAAATG Backbone Size:2686; Vector Backbone:pUC19; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-09-12 02:15:17 0
Hsh155 Hs 1-16 3x FLAG
 
Resource Report
Resource Website
RRID:Addgene_111966 Hsh155 Hs 1-16 3x FLAG Saccharomyces cerevisiae Ampicillin PMID:29752352 Backbone Marker:ATCC; Backbone Size:5208; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin Human HEATs 1-16 inserted 2026-09-12 02:15:16 0
pAAV-hSynapsin1-axon-GCaMP6f
 
Resource Report
Resource Website
RRID:Addgene_112000 axon-GCaMP6f Synthetic Ampicillin PMID:30127424 Backbone Size:4579; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-09-12 02:15:17 0
Hsh155 V783A
 
Resource Report
Resource Website
RRID:Addgene_111950 Hsh155 V783A Saccharomyces cerevisiae Ampicillin PMID:29752352 Backbone Marker:ATCC; Backbone Size:4788; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin V783A 2026-09-12 02:15:16 0
pAAV-hSynapsin1-axon-GCaMP6s-P2A-mRuby3
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_112005 axon-GCaMP6s-P2A-mRuby3 Synthetic Ampicillin PMID:30127424 Addgene NGS results found minor differences in the second ITR compared to the depositor-provided sequence. The depositing lab has confirmed that this does not impair AAV production Backbone Size:4603; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-09-12 02:15:17 7
Hsh155 1-945
 
Resource Report
Resource Website
RRID:Addgene_112002 Hsh155 1-945 Saccharomyces cerevisiae Ampicillin PMID:29752352 Backbone Marker:ATCC; Backbone Size:5208; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin 1-945 truncation 2026-09-12 02:15:17 0
Hsh155 K740R
 
Resource Report
Resource Website
RRID:Addgene_111953 Hsh155 K740R Saccharomyces cerevisiae Ampicillin PMID:29752352 Backbone Marker:ATCC; Backbone Size:4788; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin K740R 2026-09-12 02:15:16 0
pAAV-hSynapsin1-FLEx-axon-GCaMP6s-P2A-mRuby3
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_112008 axon-GCaMP6s-P2A-mRuby3 Synthetic Ampicillin PMID:30127424 Backbone Size:5109; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin 2026-09-12 02:15:17 4
Hsh155 N747D
 
Resource Report
Resource Website
RRID:Addgene_111954 Hsh155 N747D Saccharomyces cerevisiae Ampicillin PMID:29752352 Backbone Marker:ATCC; Backbone Size:4788; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin N747D 2026-09-12 02:15:16 0
Hsh155 K818A
 
Resource Report
Resource Website
RRID:Addgene_111951 Hsh155 K818A Saccharomyces cerevisiae Ampicillin PMID:29752352 Backbone Marker:ATCC; Backbone Size:4788; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin K818A 2026-09-12 02:15:16 0
pAAV-hSynapsin1-GCaMP6s-P2A-mKate2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_112006 GCaMP6s-P2A-mKate2 Synthetic Ampicillin PMID:30127424 Addgene NGS results found minor differences in the second ITR compared to the depositor-provided sequence. The depositing lab has confirmed that this does not impair AAV production Backbone Size:4603; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-09-12 02:15:17 1
Hsh155 Y826A
 
Resource Report
Resource Website
RRID:Addgene_111952 Hsh155 Y826A Saccharomyces cerevisiae Ampicillin PMID:29752352 Backbone Marker:ATCC; Backbone Size:4788; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin Y826A 2026-09-12 02:15:16 0
pAAV-hSynapsin1-GCaMP6s-P2A-mRuby3
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_112007 GCaMP6s-P2A-mRuby3 Synthetic Ampicillin PMID:30127424 Addgene NGS results found minor differences in the second ITR compared to the depositor-provided sequence. The depositing lab has confirmed that this does not impair AAV production Backbone Size:4603; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-09-12 02:15:17 1
pJB01
 
Resource Report
Resource Website
RRID:Addgene_111957 RFP Ampicillin PMID:29671583 Backbone Marker:ThermoFisherScientific; Backbone Size:2900; Vector Backbone:prSET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:15:16 0
Hsh155 V783L
 
Resource Report
Resource Website
RRID:Addgene_111955 Hsh155 V783L Saccharomyces cerevisiae Ampicillin PMID:29752352 Backbone Marker:ATCC; Backbone Size:4788; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin V783L 2026-09-12 02:15:16 0
pJB02
 
Resource Report
Resource Website
RRID:Addgene_111959 mEGFP Ampicillin PMID:29671583 Backbone Size:4346; Vector Backbone:pETARA; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin enhanced GFP with monomerizing A206K mutation 2026-09-12 02:15:16 0
pORFE0005
 
Resource Report
Resource Website
RRID:Addgene_112073 AtDeadCAS9 D10A H840A without stop codon Other Spectinomycin BsaI and BbsI sites have been removed from the sequence by site-directed mutagenesis. Vector Backbone:pAGM1287; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Spectinomycin Plant codon optimized dCas9 D10A S. pyogenes 2026-09-12 02:15:18 0
pORFE0010
 
Resource Report
Resource Website
RRID:Addgene_112074 3xmVenus Other Spectinomycin BsaI and BbsI sites have been removed from the sequence by site-directed mutagenesis. Vector Backbone:pAGM1301; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin Ser to Thr at amino acid 63 and Phe to Leu at position 64 2026-09-12 02:15:18 0
pORFE1052
 
Resource Report
Resource Website
RRID:Addgene_112078 AtCAS9 D10A Other Ampicillin BsaI and BbsI sites have been removed from the sequence by site-directed mutagenesis. Vector Backbone:pICH47742; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin Plant codon optimized nCas9 D10A S. pyogenes 2026-09-12 02:15:18 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. SPARC Anatomical Working Group Resources

    Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.