Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
Hsh155 Hs 1-5 3xFLAG Resource Report Resource Website |
RRID:Addgene_111963 | Hsh155 Hs 1-5 3x FLAG | Saccharomyces cerevisiae | Ampicillin | PMID:29752352 | Backbone Marker:ATCC; Backbone Size:5208; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin | Human HEATs 1-5 inserted | 2026-09-12 02:15:16 | 0 | |
|
CD4-C-GFP HDRT Source (pTR 152) Resource Report Resource Website |
RRID:Addgene_112018 | CD4-GFP HDRT | Homo sapiens | Ampicillin | PMID:29995861 | gRNA sequence that can be used with this DNA template: CTGGCCTCGTGCCTCAAATG | Backbone Size:2686; Vector Backbone:pUC19; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-09-12 02:15:17 | 0 | |
|
Hsh155 Hs 1-16 3x FLAG Resource Report Resource Website |
RRID:Addgene_111966 | Hsh155 Hs 1-16 3x FLAG | Saccharomyces cerevisiae | Ampicillin | PMID:29752352 | Backbone Marker:ATCC; Backbone Size:5208; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin | Human HEATs 1-16 inserted | 2026-09-12 02:15:16 | 0 | |
|
pAAV-hSynapsin1-axon-GCaMP6f Resource Report Resource Website |
RRID:Addgene_112000 | axon-GCaMP6f | Synthetic | Ampicillin | PMID:30127424 | Backbone Size:4579; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-09-12 02:15:17 | 0 | ||
|
Hsh155 V783A Resource Report Resource Website |
RRID:Addgene_111950 | Hsh155 V783A | Saccharomyces cerevisiae | Ampicillin | PMID:29752352 | Backbone Marker:ATCC; Backbone Size:4788; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin | V783A | 2026-09-12 02:15:16 | 0 | |
|
pAAV-hSynapsin1-axon-GCaMP6s-P2A-mRuby3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_112005 | axon-GCaMP6s-P2A-mRuby3 | Synthetic | Ampicillin | PMID:30127424 | Addgene NGS results found minor differences in the second ITR compared to the depositor-provided sequence. The depositing lab has confirmed that this does not impair AAV production | Backbone Size:4603; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-09-12 02:15:17 | 7 | |
|
Hsh155 1-945 Resource Report Resource Website |
RRID:Addgene_112002 | Hsh155 1-945 | Saccharomyces cerevisiae | Ampicillin | PMID:29752352 | Backbone Marker:ATCC; Backbone Size:5208; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin | 1-945 truncation | 2026-09-12 02:15:17 | 0 | |
|
Hsh155 K740R Resource Report Resource Website |
RRID:Addgene_111953 | Hsh155 K740R | Saccharomyces cerevisiae | Ampicillin | PMID:29752352 | Backbone Marker:ATCC; Backbone Size:4788; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin | K740R | 2026-09-12 02:15:16 | 0 | |
|
pAAV-hSynapsin1-FLEx-axon-GCaMP6s-P2A-mRuby3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_112008 | axon-GCaMP6s-P2A-mRuby3 | Synthetic | Ampicillin | PMID:30127424 | Backbone Size:5109; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-09-12 02:15:17 | 4 | ||
|
Hsh155 N747D Resource Report Resource Website |
RRID:Addgene_111954 | Hsh155 N747D | Saccharomyces cerevisiae | Ampicillin | PMID:29752352 | Backbone Marker:ATCC; Backbone Size:4788; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin | N747D | 2026-09-12 02:15:16 | 0 | |
|
Hsh155 K818A Resource Report Resource Website |
RRID:Addgene_111951 | Hsh155 K818A | Saccharomyces cerevisiae | Ampicillin | PMID:29752352 | Backbone Marker:ATCC; Backbone Size:4788; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin | K818A | 2026-09-12 02:15:16 | 0 | |
|
pAAV-hSynapsin1-GCaMP6s-P2A-mKate2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_112006 | GCaMP6s-P2A-mKate2 | Synthetic | Ampicillin | PMID:30127424 | Addgene NGS results found minor differences in the second ITR compared to the depositor-provided sequence. The depositing lab has confirmed that this does not impair AAV production | Backbone Size:4603; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-09-12 02:15:17 | 1 | |
|
Hsh155 Y826A Resource Report Resource Website |
RRID:Addgene_111952 | Hsh155 Y826A | Saccharomyces cerevisiae | Ampicillin | PMID:29752352 | Backbone Marker:ATCC; Backbone Size:4788; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin | Y826A | 2026-09-12 02:15:16 | 0 | |
|
pAAV-hSynapsin1-GCaMP6s-P2A-mRuby3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_112007 | GCaMP6s-P2A-mRuby3 | Synthetic | Ampicillin | PMID:30127424 | Addgene NGS results found minor differences in the second ITR compared to the depositor-provided sequence. The depositing lab has confirmed that this does not impair AAV production | Backbone Size:4603; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-09-12 02:15:17 | 1 | |
|
pJB01 Resource Report Resource Website |
RRID:Addgene_111957 | RFP | Ampicillin | PMID:29671583 | Backbone Marker:ThermoFisherScientific; Backbone Size:2900; Vector Backbone:prSET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:15:16 | 0 | |||
|
Hsh155 V783L Resource Report Resource Website |
RRID:Addgene_111955 | Hsh155 V783L | Saccharomyces cerevisiae | Ampicillin | PMID:29752352 | Backbone Marker:ATCC; Backbone Size:4788; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin | V783L | 2026-09-12 02:15:16 | 0 | |
|
pJB02 Resource Report Resource Website |
RRID:Addgene_111959 | mEGFP | Ampicillin | PMID:29671583 | Backbone Size:4346; Vector Backbone:pETARA; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | enhanced GFP with monomerizing A206K mutation | 2026-09-12 02:15:16 | 0 | ||
|
pORFE0005 Resource Report Resource Website |
RRID:Addgene_112073 | AtDeadCAS9 D10A H840A without stop codon | Other | Spectinomycin | BsaI and BbsI sites have been removed from the sequence by site-directed mutagenesis. | Vector Backbone:pAGM1287; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Spectinomycin | Plant codon optimized dCas9 D10A S. pyogenes | 2026-09-12 02:15:18 | 0 | |
|
pORFE0010 Resource Report Resource Website |
RRID:Addgene_112074 | 3xmVenus | Other | Spectinomycin | BsaI and BbsI sites have been removed from the sequence by site-directed mutagenesis. | Vector Backbone:pAGM1301; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin | Ser to Thr at amino acid 63 and Phe to Leu at position 64 | 2026-09-12 02:15:18 | 0 | |
|
pORFE1052 Resource Report Resource Website |
RRID:Addgene_112078 | AtCAS9 D10A | Other | Ampicillin | BsaI and BbsI sites have been removed from the sequence by site-directed mutagenesis. | Vector Backbone:pICH47742; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin | Plant codon optimized nCas9 D10A S. pyogenes | 2026-09-12 02:15:18 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
