Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species:
Genetic Insert: see comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments: MG1655 + lacIq intergrated at intS + ΔglmZ
Proper citation: RRID:Addgene_63667 Copy
Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: The genotype of the strain relative to MG1655 is complex, since there are many single nucleotide variations and several 10-20kb differences (Brown & Jun (2015) Genome Announcements, Lyons et. al. (2011) PLoS ONE). There are a particular abundance of differences in the rDNA operons, which in several cases align more closely to E. coli strains DH10B, MDS42, and W.
Particularly relevant genotypes are: λ+ gal+ eut+ pyrE+ ilvG+ rpoS33Am glnV(SupAm) evgA::IS1 Δrfb
Proper citation: RRID:Addgene_67755 Copy
Species:
Genetic Insert: MG1655 Z1 malE
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
References:
Comments: F-, lambda-, rph-1, laciq, PN25-tetR, SpR, malE-
Proper citation: RRID:Addgene_65915 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:E. coli BW25113; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:None
References:
Comments: No antibiotic resistance.
Proper citation: RRID:Addgene_72402 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments:
Proper citation: RRID:Addgene_69778 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments:
Proper citation: RRID:Addgene_69775 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments:
Proper citation: RRID:Addgene_69774 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments:
Proper citation: RRID:Addgene_69782 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments:
Proper citation: RRID:Addgene_69781 Copy
Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
References:
Comments: To be used with the following plasmids from the Matthews lab: pTARA (www.addgene.org/31491), pLS1 (www.addgene.org/31490), and (www.addgene.org/31492) pLS1/-11
Proper citation: RRID:Addgene_35609 Copy
Species:
Genetic Insert: pTet--Cas9 cassette integrated at 186 primary attB site
Vector Backbone Description: Vector Backbone:na; Vector Types:; Bacterial Resistance:None
References:
Comments:
Proper citation: RRID:Addgene_78552 Copy
Species: Mus musculus
Genetic Insert: Forkhead box O1
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:3390; Vector Backbone:pSELECT-puro; Vector Types:Mammalian Expression; Bacterial Resistance:None
References:
Comments:
Proper citation: RRID:Addgene_83379 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
References:
Comments: λ- F- glnX44 e14- (McrA-) rfbD1 endA1 thi-1 Δ(yjiT-opgB)114::IS10 (EcoKI R- M- McrBC- Mrr-) + rpoS393(am) creC510 lrhA::IS3 ydeN::IS10 ΔlacI
Verification of lacI deletion:
PCR reaction on genomic DNA using AK362 and AK365 primers produces a 1936 bp fragment
AK 362 5’-CAATACCAATCGCACGCGG
AK 365 5’-CGAGACGTCACGGAAAATGCC
Phenotype: Constitutive β-galactosidase synthesis
This strain was derived from the precursor strain, E. coli ER1821, which is described in Jobling et al. (2016) Complete Genome Sequence of Escherichia coli ER1821R, a Laboratory K-12 Derivative Engineered To Be Deficient in All Methylcytosine and Methyladenine Restriction Systems. Genome Announc 4(4):e00763-16. https://www.ncbi.nlm.nih.gov/pubmed/27516504
Proper citation: RRID:Addgene_141407 Copy
Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1
Integration at lambda attB: pOSIP-KL-sulA-GFP
Integration at HK022 attB: pOSIP-KO-RBS2-dCas9
SulA-GFP acts as an SOS response reporter.
Proper citation: RRID:Addgene_115924 Copy
Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1
Integration at lambda attB: pOSIP-KL-mCherry
Integration at primary 186 attB: pOSIP-KO-RBS2-dCas9
mCherry quantifies dCas9 repression
Proper citation: RRID:Addgene_115926 Copy
Species:
Genetic Insert: lysogen of a temperature-inducible bacteriophage lambda
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype is [λ+ Lac- galK2 IN(rrnD-rrnE)1 rph-1], a derivative of strain W3102
Phenotypic assay: Grow at 30°C, but restricted at 42°C due to the induction of phage particles and cell lysis.
Proper citation: RRID:Addgene_134836 Copy
Species: E.coli
Genetic Insert: The strain has a 535 nt deletion between nt 15 and nt 551 in the EntD gene.
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
References:
Comments: EntD, a 4'-phosphopantetheinyl transferase, is required for native enterobactin synthesis. This strain allows for expression of nonribosomal peptide synthetase (NRPS) carrier proteins that do not harbor a phosphopantetheinyl group.
Proper citation: RRID:Addgene_192874 Copy
Species:
Genetic Insert: ΔrpiAB Δedd strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
References:
Comments:
Proper citation: RRID:Addgene_234837 Copy
Species:
Genetic Insert: None
Vector Backbone Description: Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype: The same as BL21(DE3) except for the additional mutations at 95 UAG codons, disruption of prfA, and frameshift in fabR and deletion of selABC.
Proper citation: RRID:Addgene_234550 Copy
Species: n/a
Genetic Insert: MG1655 attP21::PR-mCherry::frt proC::frt hisL::frt
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
References:
Comments: Primers for sequence verification of hisL knock-out:
Fwd - prEP229, gtgaggataagaggtggcga
Rev - prEP230, tcctttccccgctcattcat
Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint.
Proper citation: RRID:Addgene_229552 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within SPARC SAWG that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.