Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Size:0; Vector Backbone:pRS415; Vector Types:Yeast Expression, Other, Gateway Destination; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17583893
Comments: Type of plasmid: CEN.
This plasmid contains the Gateway technology from Invitrogen; Invitrogen requires purchasing of Gateway Clonase for carrying out the Gateway recombinational cloning reaction http://www.invitrogen.com
Please note that the full plasmid sequence is provided as a reference only, and may not match the exact sequence of the plasmid.
Proper citation: RRID:Addgene_14193 Copy
Species: E.coli
Genetic Insert: lacZ
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pbbr; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16207908
Comments: Use gentamicin at 10 ug/mL.
Proper citation: RRID:Addgene_14467 Copy
Genetic Insert: Lineage tracing library
Vector Backbone Description: Backbone Marker:Allon Klein; Vector Backbone:pLARRY-EGFP; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31974159
Proper citation: RRID:Addgene_140024 Copy
Species: Mus musculus
Genetic Insert: mTERT
Vector Backbone Description: Backbone Marker:Bob Weinberg (Addgene Plasmid #1764); Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21732358
Proper citation: RRID:Addgene_36413 Copy
Vector Backbone Description: Backbone Size:5729; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning.
8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases.
8HR adds a TEV-cleavable His6 and a strep tag to the N terminus of your protein. The dual affinity tags can help to purify difficult proteins.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
Visit http://qb3.berkeley.edu/qb3/macrolab/ for more information on this vector can be found through
Proper citation: RRID:Addgene_37505 Copy
Species: Mus musculus
Genetic Insert: mMCL1(T144D)
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBabe IRES puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19433446
Proper citation: RRID:Addgene_25388 Copy
Species: Homo sapiens
Genetic Insert: hDna2
Vector Backbone Description: Backbone Size:5200; Vector Backbone:pBabe hygro 3xFLAG; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22570476
Comments: to get 3XFLAG hDna2 out cut with BAMH1 and SAL1
Proper citation: RRID:Addgene_31955 Copy
Vector Backbone Description: Backbone Size:4888; Vector Backbone:pBABE-zeo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2194165
Comments: Please acknowledge Jay Morgenstern and Hartmut Land and cite the following article if you use this plasmid in a publication:
Morgenstern JP, Land H., 1990, Nucleic Acids Research 18(12):3587-96.
SspI site in Amp gene.
If you are using the pBABE protocol from the Weinberg Lab to generate virus, please note that the Weinberg Lab recommends using pUMVC (Addgene #8449) and VSV-G (#8454) for packaging. The pCL-Eco plasmid listed in their protocol should be substituted with pUMVC.
Proper citation: RRID:Addgene_1766 Copy
Species: Homo sapiens
Genetic Insert: YTHDC1
Vector Backbone Description: Vector Backbone:modified from Addgene 61425; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34375583
Proper citation: RRID:Addgene_177129 Copy
Species: Rattus norvegicus
Genetic Insert: microtubule-associated protein 1 light chain 3 beta
Vector Backbone Description: Backbone Marker:Addgene plasmid # 1764; Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18094039
Comments: LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. Kabeya Y et al. (EMBO J. 2000 Nov 1. 19(21):5720-8.
Proper citation: RRID:Addgene_22405 Copy
Species: Homo sapiens
Genetic Insert: eGFPhTERT
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pBABEhygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12198499
Proper citation: RRID:Addgene_28169 Copy
Species: Homo sapiens
Genetic Insert: c-myc
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBabepuro3:hbER tam; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15367674
Comments: Please see Littlewood et al., Nucleic Acids Res. 1995 May 25;23(10):1686-90 for more information regarding the mutant hormone binding domain of the mouse estrogen receptor (hbER Tam).
Proper citation: RRID:Addgene_19128 Copy
Species: Other
Genetic Insert: TRANSPORT INHIBITOR RESPONSE 1
Vector Backbone Description: Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23150568
Comments: Nishimura et al., 2009, Nature Methods
Please note that this version contains a nuclear export signal. A related construct without the NES can be found at: http://www.addgene.org/64945/
Proper citation: RRID:Addgene_47328 Copy
Species: Homo sapiens
Genetic Insert: KIBRA
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22614006
Proper citation: RRID:Addgene_40887 Copy
Species: Homo sapiens
Genetic Insert: KRAS*G12V
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE-Puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23246410
Proper citation: RRID:Addgene_46746 Copy
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pWSK29; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16547065
Proper citation: RRID:Addgene_172972 Copy
Species: Synthetic
Genetic Insert: eGFP
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21267423
Proper citation: RRID:Addgene_174006 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33854235
Proper citation: RRID:Addgene_172604 Copy
Genetic Insert: TetON-P2A-TetOFF-T2A-bsd
Vector Backbone Description: Backbone Size:7821; Vector Backbone:Custom; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31268602
Comments: The plasmid can be used in conjunction with pLenti-Tet (Addgene #138086) that has the ORF for the gene of interest of which expression can then be induced with Tetracycline or Doxycyline in Mammalian cells.
Proper citation: RRID:Addgene_138085 Copy
Vector Backbone Description: Backbone Size:5558; Vector Backbone:pBABE-hygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2194165
Comments: Please acknowledge Jay Morgenstern and Hartmut Land and cite the following article if you use this plasmid in a publication:
Morgenstern JP, Land H., 1990, Nucleic Acids Research 18(12):3587-96.
If you are using the pBABE protocol from the Weinberg Lab to generate virus, please note that the Weinberg Lab recommends using pUMVC (Addgene #8449) and VSV-G (#8454) for packaging. The pCL-Eco plasmid listed in their protocol should be substituted with pUMVC.
Please note that the sequence from which the Addgene map was generated is an estimate of the real sequence based on how the vector was assembled. We encourage scientists to test enzymes before using them for cloning.
Proper citation: RRID:Addgene_1765 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within SPARC SAWG that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.