Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Rab6B
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:EGFP C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_49889 Copy
Species: Homo sapiens
Genetic Insert: Arf6
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:EGFP N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_49883 Copy
Species: Homo sapiens
Genetic Insert: Desmoglein1
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mApple-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 568; Emission = 592
Proper citation: RRID:Addgene_54887 Copy
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:7701; Vector Backbone:pET, pCoofy4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23410102
Comments: C-terminal tags are separated by a stop codon. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene.
Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer:
LP1 forward vector primer:
SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3'
LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest:
none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3'
10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3'
StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3'
S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3'
CBP - SLIC Primer 5`ATGAAGCGGCGGTGGAAGAAAAAC 3'
HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3'
Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3'
Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.
Proper citation: RRID:Addgene_55187 Copy
Species: Homo sapiens
Genetic Insert: Zyxin
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mRFP1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 584; Emission = 607
Proper citation: RRID:Addgene_55925 Copy
Species: Homo sapiens
Genetic Insert: H2B
Vector Backbone Description: Backbone Size:4750; Vector Backbone:rsEGFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_56533 Copy
Species: Homo sapiens
Genetic Insert: NM_003380.3
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mTagRFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18454154
Comments: . Excitation = 555; Emission = 584
Proper citation: RRID:Addgene_58029 Copy
Genetic Insert: SpCas9
Vector Backbone Description: Vector Backbone:pBBR1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:40087133
Comments: Please visit https://doi.org/10.1101/2024.11.24.625072 for bioRxiv preprint.
Proper citation: RRID:Addgene_235165 Copy
Species: Homo sapiens
Genetic Insert: EGFR
Vector Backbone Description: Vector Backbone:pFC220K SmBiT CMV-Blast Flexi Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_238754 Copy
Species: Homo sapiens
Genetic Insert: VHL
Vector Backbone Description: Vector Backbone:pFC221K HaloTag(R) CMV-Blast BiBRET Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_238752 Copy
Species: Homo sapiens
Genetic Insert: CHRM1
Vector Backbone Description: Vector Backbone:pBiT3.1-N [CMV/HiBiT/Blast] Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_236898 Copy
Species: Homo sapiens
Genetic Insert: MAVS
Vector Backbone Description: Vector Backbone:pFN224C NanoLuc(R) CMV-Neo BiBRET-Balanced Vector and pFN222K HaloTag(R) CMV-Blast BiBRET Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_238826 Copy
Species: Homo sapiens
Genetic Insert: IRF5
Vector Backbone Description: Vector Backbone:pFN31K Nluc CMV-neo Flexi(R) Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_237150 Copy
Species: Homo sapiens
Genetic Insert: HshnRNPH1
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_148142 Copy
Species: Homo sapiens
Genetic Insert: Hs4EHP-W95A
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28698298
Comments: ORF extracted from NCBI:NM_004846 or UniProt.: O60573-1 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_148586 Copy
Vector Backbone Description: Vector Backbone:pCA; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32161816
Proper citation: RRID:Addgene_187543 Copy
Vector Backbone Description: Vector Backbone:pCO; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32161816
Proper citation: RRID:Addgene_187549 Copy
Vector Backbone Description: Vector Backbone:pAN; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32161816
Proper citation: RRID:Addgene_187535 Copy
Vector Backbone Description: Vector Backbone:pAN; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32161816
Proper citation: RRID:Addgene_187534 Copy
Vector Backbone Description: Vector Backbone:pAN; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32161816
Proper citation: RRID:Addgene_187532 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within SPARC SAWG that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.