Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Bacterial Resistance:ampicillin (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

329,057 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pAAVLINKv1-pCALM1-Cre-3' ARHGEF10
 
Resource Report
Resource Website
RRID:Addgene_236685 ARHGEF10 Homo sapiens Ampicillin Backbone Marker:Addgene; Vector Backbone:pAAV-hSyn-EGFP; Vector Types:AAV, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-29 01:24:43 0
pAAVLINKv1-pCALM1-Cre-3' KDM6B
 
Resource Report
Resource Website
RRID:Addgene_236675 KDM6B Homo sapiens Ampicillin Backbone Marker:Addgene; Vector Backbone:pAAV-hSyn-EGFP; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-29 01:24:43 0
pAAVLINKv1-pCALM1-Cre-3' ERBIN
 
Resource Report
Resource Website
RRID:Addgene_236693 ERBIN Homo sapiens Ampicillin Backbone Marker:Addgene; Vector Backbone:pAAV-hSyn-EGFP; Vector Types:AAV, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-29 01:24:43 0
pAAVLINKv1-pCALM1-Cre-3' RALGAPB
 
Resource Report
Resource Website
RRID:Addgene_236667 RALGAPB Homo sapiens Ampicillin Backbone Marker:Addgene; Vector Backbone:pAAV-hSyn-EGFP; Vector Types:AAV, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-29 01:24:43 0
NanoBRET Assay Vector, HaloTag-PSMD3
 
Resource Report
Resource Website
RRID:Addgene_238750 PSMD3 Homo sapiens Ampicillin Vector Backbone:pFN21A HaloTag(R) CMV Flexi(R) Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin None 2026-08-29 01:25:06 0
pAAVLINKv1-pCALM1-Cre-3' PXDN
 
Resource Report
Resource Website
RRID:Addgene_236699 PXDN Homo sapiens Ampicillin Backbone Marker:Addgene; Vector Backbone:pAAV-hSyn-EGFP; Vector Types:AAV, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-29 01:24:18 0
pAAVLINK-EF1alpha-5' PXDN
 
Resource Report
Resource Website
RRID:Addgene_236698 PXDN Homo sapiens Ampicillin Backbone Marker:Addgene; Vector Backbone:pAAV-hSyn-EGFP; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-29 01:24:18 0
pAAVLINKv1-pCALM1-Cre-3' CECR2
 
Resource Report
Resource Website
RRID:Addgene_236703 CECR2 Homo sapiens Ampicillin Backbone Marker:Addgene; Vector Backbone:pAAV-hSyn-EGFP; Vector Types:AAV, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-29 01:24:18 0
pAAVLINKv1-pCALM1-Cre-3' CUL7
 
Resource Report
Resource Website
RRID:Addgene_236713 CUL7 Homo sapiens Ampicillin Backbone Marker:Addgene; Vector Backbone:pAAV-hSyn-EGFP; Vector Types:AAV, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-29 01:24:18 0
pAAVLINK-EF1alpha-5' CUL7
 
Resource Report
Resource Website
RRID:Addgene_236712 CUL7 Homo sapiens Ampicillin Backbone Marker:Addgene; Vector Backbone:pAAV-hSyn-EGFP; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-29 01:24:18 0
UPA-DD with microexon
 
Resource Report
Resource Website
RRID:Addgene_238353 Microexon E35a Mus musculus Ampicillin Microexon E35a sequence: gagacagagtcagatcaagatgatgag Vector Backbone:pCAGGS; Vector Types:Mammalian Expression, Other, TOPO TA vector; Bacterial Resistance:Ampicillin E35a (exon 35a) 2026-08-29 01:24:36 0
PRMT1
 
Resource Report
Resource Website
RRID:Addgene_155845 PRMT1 Homo sapiens Ampicillin Backbone Size:7357; Vector Backbone:E2.pEF5-DEST-FL-V5-MCP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin none 2026-08-29 01:14:46 0
pMDLg.pRRE
 
Resource Report
Resource Website
RRID:Addgene_225570 Ampicillin PMID:39804967 Please visit https://ssrn.com/abstract=4912248 for preprint. Backbone Marker:Naldini group; Vector Backbone:pMDLg.pRRE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:23:08 0
AiP1233 - pAAV-AiE0128h-minBG-FlpO-WPRE-HGHpA
 
Resource Report
Resource Website
RRID:Addgene_230597 FlpO Synthetic Ampicillin PMID:38915722 Vector Backbone:pAAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-29 01:23:14 0
AiP1231 - pAAV-AiE0082h-minBG-FlpO-WPRE-HGHpA
 
Resource Report
Resource Website
RRID:Addgene_230596 FlpO Synthetic Ampicillin PMID:38915722 Vector Backbone:pAAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-29 01:23:16 0
LARRYv2-mScarlet library 1
 
Resource Report
Resource Website
RRID:Addgene_233697 >50 million 34-bp barcodes Synthetic Ampicillin PMID:40010350 Vector Backbone:pLARRYv2-mScarlet; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-29 01:23:05 0
pTripZ-Tet-ON mCherry
 
Resource Report
Resource Website
RRID:Addgene_187262 mCherry-NLS Synthetic Ampicillin PMID:32467325 Backbone Size:12606; Vector Backbone:pTripZ; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-29 01:22:49 0
pAAV-ACTSTar-O2-GAD1-g2
 
Resource Report
Resource Website
RRID:Addgene_225345 Gad1 Mus musculus Ampicillin Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin 2026-08-29 01:22:10 0
pAAV-ACTSTar-O2-Vector
 
Resource Report
Resource Website
RRID:Addgene_225344 Ampicillin Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin 2026-08-29 01:22:12 0
pAAV-ACTSTar-O2-SLC17a7-g3
 
Resource Report
Resource Website
RRID:Addgene_225346 Slc17A7 Mus musculus Ampicillin Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin 2026-08-29 01:22:08 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. SPARC Anatomical Working Group Resources

    Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.