Plasmids   Select Another Resource Report Type

http://www.addgene.org/53197

Species: Homo sapiens
Genetic Insert: MEK1
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24717435
Comments: The S241P mutation found during the QC process has no functional consequence. This plasmid is prone to recombination. We recommend screening 2-3 colonies to ensure that the full plasmid is selected.

Proper citation: RRID:Addgene_53197 Copy   

•   Source: Addgene

http://www.addgene.org/73696

Genetic Insert: sgCentromere-20xPBSc
Vector Backbone Description: Vector Backbone:pX330; pUC ori vector; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26768771
Comments: Please visit http://casil.io for more information, updates and protocols

Proper citation: RRID:Addgene_73696 Copy   

•   Source: Addgene

http://www.addgene.org/64945

Species: Other
Genetic Insert: TRANSPORT INHIBITOR RESPONSE 1
Vector Backbone Description: Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23150568
Comments: Nishimura et al., 2009, Nature Methods Please note that this version does not contains a nuclear export signal. A related construct with the NES can be found at: http://www.addgene.org/47328/

Proper citation: RRID:Addgene_64945 Copy   

•   Source: Addgene

http://www.addgene.org/61325

Genetic Insert: Green fluorescent protein
Vector Backbone Description: Vector Backbone:pHT-01; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25386923

Proper citation: RRID:Addgene_61325 Copy   

•   Source: Addgene

http://www.addgene.org/26790

Species: Homo sapiens
Genetic Insert: H2B-GFP
Vector Backbone Description: Backbone Marker:Bob Weinberg, Addgene plasmid 1764; Backbone Size:5200; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20551166
Comments: H2B-GFP was cloned from pBOS-H2B-GFP (BD Biosciences) into the pBABE retroviral vector.

Proper citation: RRID:Addgene_26790 Copy   

•   Source: Addgene

http://www.addgene.org/26926

Species: Mus musculus
Genetic Insert: autophagy-related 3 (yeast)
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20723759

Proper citation: RRID:Addgene_26926 Copy   

•   Source: Addgene

http://www.addgene.org/62923

Species: Homo sapiens
Genetic Insert: IDH1
Vector Backbone Description: Backbone Marker:Addgene plasmid # 1764; Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19359588

Proper citation: RRID:Addgene_62923 Copy   

•   Source: Addgene

http://www.addgene.org/62924

Species: Homo sapiens
Genetic Insert: IDH1
Vector Backbone Description: Backbone Marker:Addgene plasmid # 1764; Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19359588

Proper citation: RRID:Addgene_62924 Copy   

•   Source: Addgene

http://www.addgene.org/63087

Species: Synthetic
Genetic Insert: CTG REPEATS
Vector Backbone Description: Vector Backbone:unknown; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Comments: Addgene cannot verify or guarantee the presence of all 700 CTG repeats in this array Should be amplified in STBL3 bacteria and grown at Room temperature to keep the repeats stable. This plasmid should be verified via restriction analysis. Multiple colonies may need to be screened to isolate the correct construct.

Proper citation: RRID:Addgene_63087 Copy   

•   Source: Addgene

http://www.addgene.org/63089

Species: Homo sapiens
Genetic Insert: expanded CGG repeats (99 repeats) within the 5'UTR of FMR1
Vector Backbone Description: Vector Backbone:unknown; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Should be amplified in STBL3 bacteria and grown at Room temperature to keep the repeats stable. This construct allows translation of CGG repeats into 99 glycine due to a near cognate ATG codon upstream of the repeat in the 5'UTR of FMR1 (an ACG codon that initiates weakly translation). This plasmid should be verified via restriction analysis. Multiple colonies may need to be screened to isolate the correct construct.

Proper citation: RRID:Addgene_63089 Copy   

•   Source: Addgene

http://www.addgene.org/64611

Species: Homo sapiens
Genetic Insert: STAT3
Vector Backbone Description: Backbone Marker:John Doench/Kathleen Ottina; Backbone Size:9240; Vector Backbone:pcw107 (V5); Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25538079
Comments: CAGA (N-term barcode, 17 nt upstream of CDS start). Working name: CTK-D2-V5

Proper citation: RRID:Addgene_64611 Copy   

•   Source: Addgene

http://www.addgene.org/50436

Species: Homo sapiens
Genetic Insert: EPO
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:9387; Vector Backbone:pLenti6.3/V5-DEST gateway vector; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21937702
Comments: Human erythropoietin (hEPO) ORF with stop codon (582 bp; Ultimate ORF clone number IOH7334) from GeneCopoeia ORF cDNA clones in pDONR vector (GeneCopoeia; GC-A1011). Because the stop codon is inserted before V5 epitope, the V5 tag on the pLenti6.3/V5-DEST vector won’t be transcribed.

Proper citation: RRID:Addgene_50436 Copy   

•   Source: Addgene

http://www.addgene.org/53893

Species: Homo sapiens
Genetic Insert: COL6A1
Vector Backbone Description: Backbone Marker:Lawson Lab (Addgene Plasmid 22423); Backbone Size:4095; Vector Backbone:pCSDest; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29760202
Comments: BC052575

Proper citation: RRID:Addgene_53893 Copy   

•   Source: Addgene

http://www.addgene.org/61572

Species: Mus musculus
Genetic Insert: Pvalb-2A-Flpo
Vector Backbone Description: Backbone Size:2682; Vector Backbone:pUC57; Vector Types:Recombinase-mediated cassette exchange using Flp recombinase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25741722

Proper citation: RRID:Addgene_61572 Copy   

•   Source: Addgene

http://www.addgene.org/48282

Vector Backbone Description: Backbone Size:5767; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty destination vector. It is a polycistronic vector that can express up to five genes at once. Genes must first be cloned into any of our 8-series transfer vectors (8BT,8CT,8UT), then subcloned into any of the five cassettes of the destination vector: Cassette 1: BamHI/XbaI Cassette 2: AsiSI/PspXI Cassette 3: SbfI/AscI Cassette 4: AdeI/NotI Cassette 5: PacI/FseI Please note that you must always insert your gene into the lowest cassette number first (e.g., if you're using cassettes 2 and 3, you must put your gene into cassette 2 first, then move on to cassette 3). You do not have to use all of the cassettes. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48282 Copy   

•   Source: Addgene

http://www.addgene.org/48280

Vector Backbone Description: Backbone Size:6906; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning. 8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases. 8CT adds a TEV-cleavable His6-MBP tag to the N-terminus of your protein. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.This vector is a transfer vector that can be used in conjunction with the 8D destination vector to create a polycistronic construct. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48280 Copy   

•   Source: Addgene

http://www.addgene.org/48281

Vector Backbone Description: Backbone Size:5706; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning. 8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases. 8UT adds a MYFQSNA tag to the N-terminus of your protein. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. This vector is a transfer vector that can be used in conjunction with the 8D destination vector to create a polycistronic construct. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ Note: The plasmid as it is provided enocdes "MYFQSNI". However, the vector is supposed to be cut with SspI (AATATT), which is a blunt cutter that cuts between the N and the "I" (this ends up not being transcribed, however). Then, provided you use the LIC tags on your PCR primers that we've suggested, the forward primer will introduce an A residue immediately downstream of the N. The final tag, therefore, is MYFQSNA.

Proper citation: RRID:Addgene_48281 Copy   

•   Source: Addgene

http://www.addgene.org/48279

Vector Backbone Description: Backbone Size:5742; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning. 8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases.8BT adds a TEV-cleavable His6 tag to the N-terminus of your protein. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify.When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. This vector is a transfer vector that can be used in conjunction with the 8D destination vector to create a polycistronic construct. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48279 Copy   

•   Source: Addgene

http://www.addgene.org/49163

Species: Homo sapiens
Genetic Insert: Malic Enzyme 1
Vector Backbone Description: Backbone Marker:Addgene plasmid # 1764; Backbone Size:5169; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23334421

Proper citation: RRID:Addgene_49163 Copy   

•   Source: Addgene

http://www.addgene.org/49567

Species: Homo sapiens
Genetic Insert: Rab6A
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17908815

Proper citation: RRID:Addgene_49567 Copy   

•   Source: Addgene