Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 13 showing 241 ~ 260 out of 740,833 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_124962

http://www.addgene.org/124962

Species: Homo sapiens
Genetic Insert: human APOAI gene
Vector Backbone Description: Backbone Marker:BCM; Backbone Size:24000; Vector Backbone:pD21; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12742997
Comments: Please note plasmid was difficult to sequence due to its size. Addgene NGS results contain several ambiguous bases. We advise running additional diagnostic tests before use. The backbone was developed at BCM. The relevant reference is Proc. Natl. Acad Sci. USA 98: 13282-13287.

Proper citation: RRID:Addgene_124962 Copy   


  • RRID:Addgene_125127

http://www.addgene.org/125127

Species: Other
Genetic Insert: FAR protein
Vector Backbone Description: Backbone Size:6457; Vector Backbone:piggyback; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_125127 Copy   


  • RRID:Addgene_125128

http://www.addgene.org/125128

Species: Other
Genetic Insert: FAR protein
Vector Backbone Description: Backbone Size:6457; Vector Backbone:piggyback; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_125128 Copy   


  • RRID:Addgene_125126

http://www.addgene.org/125126

Species: Other
Genetic Insert: FAR protein
Vector Backbone Description: Backbone Size:6457; Vector Backbone:piggyback; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_125126 Copy   


  • RRID:Addgene_125129

http://www.addgene.org/125129

Species: Other
Genetic Insert: FAR protein
Vector Backbone Description: Backbone Size:6457; Vector Backbone:piggyback; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_125129 Copy   


  • RRID:Addgene_125850

http://www.addgene.org/125850

Species: Homo sapiens
Genetic Insert: SUN1_916
Vector Backbone Description: Backbone Marker:clonetech; Backbone Size:4700; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27858498

Proper citation: RRID:Addgene_125850 Copy   


  • RRID:Addgene_13318

    This resource has 1+ mentions.

http://www.addgene.org/13318

Species: Homo sapiens
Genetic Insert: PINK1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:8688; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15824318

Proper citation: RRID:Addgene_13318 Copy   


  • RRID:Addgene_108552

http://www.addgene.org/108552

Genetic Insert: 2x Streptococcus pyogenes sgRNA
Vector Backbone Description: Backbone Size:2739; Vector Backbone:pTAKN2; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29403014

Proper citation: RRID:Addgene_108552 Copy   


  • RRID:Addgene_104963

    This resource has 10+ mentions.

http://www.addgene.org/104963

Species: Other
Genetic Insert: Rep2/Cap2
Vector Backbone Description: Vector Backbone:pUC19 with additional elements; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Comments: Contains the p5 promoter upstream of RepCap as well as the p5 promoter downstream of RepCap in the 3' orientation. This configuration of promoters has been shown to improve viral production yields.

Proper citation: RRID:Addgene_104963 Copy   


  • RRID:Addgene_104964

    This resource has 10+ mentions.

http://www.addgene.org/104964

Species: Other
Genetic Insert: Rep2/Cap5
Vector Backbone Description: Vector Backbone:pUC19 with additional elements; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Comments: Contains the p5 promoter upstream of RepCap as well as the p5 promoter downstream of RepCap in the 3' orientation. This configuration of promoters has been shown to improve viral production yields.

Proper citation: RRID:Addgene_104964 Copy   


  • RRID:Addgene_103346

http://www.addgene.org/103346

Species: Homo sapiens
Genetic Insert: hsa-miR-210-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103346 Copy   


  • RRID:Addgene_103347

http://www.addgene.org/103347

Species: Homo sapiens
Genetic Insert: hsa-miR-210-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103347 Copy   


  • RRID:Addgene_103450

http://www.addgene.org/103450

Species: Homo sapiens
Genetic Insert: hsa-miR-338-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103450 Copy   


  • RRID:Addgene_1000000044

https://www.addgene.org/kits/marillonnet-moclo/

Vector Backbone Description: Vector Types:Unspecified
Comments: pAGM1251 (Addgene #47995), pAGM1263 (Addgene #47985), pAGM1276 (Addgene #47986), pAGM1287 (Addgene #47996), pAGM1299 (Addgene #47988), pAGM1301 (Addgene #47989), pAGM1311 (Addgene #47983), pAGM4673 (Addgene #48014), pAGM4723 (Addgene #48015), pAGM8031 (Addgene #48037), pAGM8043 (Addgene #48038), pAGM8055 (Addgene #48039), pAGM8067 (Addgene #48040), pAGM8079 (Addgene #48041), pAGM8081 (Addgene #48042), pAGM8093 (Addgene #48043), pAGM9121 (Addgene #51833), pICH41233 (Addgene #47984), pICH41246 (Addgene #47992), pICH41258 (Addgene #47987), pICH41264 (Addgene #47993), pICH41276 (Addgene #47994), pICH41295 (Addgene #47997), pICH41308 (Addgene #47998), pICH41331 (Addgene #47999), pICH41722 (Addgene #48016), pICH41744 (Addgene #48017), pICH41766 (Addgene #48018), pICH41780 (Addgene #48019), pICH41800 (Addgene #48020), pICH41822 (Addgene #48021), pICH47732 (Addgene #48000), pICH47742 (Addgene #48001), pICH47751 (Addgene #48002), pICH47761 (Addgene #48003), pICH47772 (Addgene #48004), pICH47781 (Addgene #48005), pICH47791 (Addgene #48006), pICH47802 (Addgene #48007), pICH47811 (Addgene #48008), pICH47822 (Addgene #48009), pICH47831 (Addgene #48010), pICH47841 (Addgene #48011), pICH47852 (Addgene #48012), pICH47861 (Addgene #48013), pICH49244 (Addgene #48029), pICH49255 (Addgene #48023), pICH49266 (Addgene #48024), pICH49277 (Addgene #48025), pICH49283 (Addgene #48026), pICH49299 (Addgene #48027), pICH49300 (Addgene #48028), pICH50866 (Addgene #48022), pICH50872 (Addgene #48044), pICH50881 (Addgene #48045), pICH50892 (Addgene #48046), pICH50900 (Addgene #48047), pICH50914 (Addgene #48048), pICH50927 (Addgene #48049), pICH50932 (Addgene #48050), pICH53388 (Addgene #47990), pICH53399 (Addgene #47991), pICH54011 (Addgene #48065), pICH54022 (Addgene #48066), pICH54033 (Addgene #48067), pICH54044 (Addgene #48068), pICH54055 (Addgene #48069), pICH54066 (Addgene #48070), pICH54077 (Addgene #48071), pICH75322 (Addgene #48051), pICH75334 (Addgene #48052), pICH75344 (Addgene #48053), pICH75355 (Addgene #48054), pICH75366 (Addgene #48055), pICH75377 (Addgene #48056), pICH75388 (Addgene #48057), pICH79255 (Addgene #48058), pICH79264 (Addgene #48059), pICH79277 (Addgene #48060), pICH79289 (Addgene #48061), pICH79290 (Addgene #48062), pICH79300 (Addgene #48063), pICH79311 (Addgene #48064), pICH82094 (Addgene #48074), pICH82113 (Addgene #48073), pICH83955 (Addgene #48036), pICH83966 (Addgene #48030), pICH83977 (Addgene #48031), pICH83988 (Addgene #48032), pICH83999 (Addgene #48033), pICH84000 (Addgene #48034), pICH84011 (Addgene #48035), pICH86966 (Addgene #48075), pICH86988 (Addgene #48076), pICH89921 (Addgene #48072)

Proper citation: RRID:Addgene_1000000044 Copy   


https://www.addgene.org/pooled-library/zhang-human-gecko-v2/

Vector Backbone Description: Vector Types:CRISPR, Lentiviral, Mammalian Expression
Comments: GeCKO v2 human library in lentiGuide-Puro A (Addgene #52959), GeCKO v2 human library in lentiGuide-Puro B (Addgene #52960), lentiCas9-Blast (Addgene #52962)

Proper citation: RRID:Addgene_1000000049 Copy   


https://www.addgene.org/kits/yamamoto-multiplex-crispr/

Vector Backbone Description: Vector Types:CRISPR, Mammalian Expression
Comments: pX330A-1x2 (Addgene #58766), pX330A-1x3 (Addgene #58767), pX330A-1x4 (Addgene #58768), pX330A-1x5 (Addgene #58769), pX330A-1x6 (Addgene #58770), pX330A-1x7 (Addgene #58771), pX330A_D10A-1x2 (Addgene #58772), pX330A_D10A-1x3 (Addgene #58773), pX330A_D10A-1x4 (Addgene #58774), pX330A_D10A-1x5 (Addgene #58775), pX330A_D10A-1x6 (Addgene #58776), pX330A_D10A-1x7 (Addgene #58777), pX330S-2 (Addgene #58778), pX330S-3 (Addgene #58779), pX330S-4 (Addgene #58780), pX330S-5 (Addgene #58781), pX330S-6 (Addgene #58782), pX330S-7 (Addgene #58783)

Proper citation: RRID:Addgene_1000000055 Copy   


  • RRID:Addgene_1000000058

https://www.addgene.org/kits/pcrisystem/

Vector Backbone Description: Vector Types:Bacterial Expression, Yeast Expression
Comments: pCri-11a (Addgene #61319), pCri-11b (Addgene #61333), pCri-12a (Addgene #61320), pCri-12b (Addgene #61334), pCri-13a (Addgene #61321), pCri-14a (Addgene #61322), pCri-14b (Addgene #61335), pCri-15a (Addgene #61323), pCri-15b (Addgene #61336), pCri-16a (Addgene #61324), pCri-17a (Addgene #61325), pCri-18a (Addgene #61326), pCri-1a (Addgene #60816), pCri-1a-Strep (Addgene #61337), pCri-1b (Addgene #61327), pCri-4a (Addgene #61314), pCri-4a-Strep (Addgene #61338), pCri-4b (Addgene #61328), pCri-6a (Addgene #61315), pCri-6b (Addgene #61329), pCri-7a (Addgene #61316), pCri-7a-Strep (Addgene #61339), pCri-7b (Addgene #61330), pCri-8a (Addgene #61317), pCri-8a-Strep (Addgene #61340), pCri-8b (Addgene #61331), pCri-9a (Addgene #61318), pCri-9a-Strep (Addgene #61341), pCri-9b (Addgene #61332)

Proper citation: RRID:Addgene_1000000058 Copy   


  • RRID:Addgene_1000000059

https://www.addgene.org/kits/densmore-cidar-moclo/

Vector Backbone Description: Vector Types:Gateway Cloning, Synthetic Biology
Comments: B0015_DE (Addgene #66035), B0015_DF (Addgene #66036), B0015_DG (Addgene #66037), B0015_DH (Addgene #66038), B0032m_BC (Addgene #66020), B0033m_BC (Addgene #66021), B0034m_BC (Addgene #66022), BCD12_BC (Addgene #66023), BCD2_BC (Addgene #66024), BCD8_BC (Addgene #66025), C0012m (lacI)_CD (Addgene #66026), C0040 (tetR)_CD (Addgene #66027), C0062 (luxR)_CD (Addgene #66028), C0080 (araC)_CD (Addgene #66029), cre_CD (Addgene #66030), DVA (Addgene #66056), DVA_AB (Addgene #66039), DVA_AE (Addgene #66040), DVA_AF (Addgene #66041), DVA_AG (Addgene #66042), DVA_AH (Addgene #66043), DVA_BC (Addgene #66044), DVA_CD (Addgene #66045), DVA_DE (Addgene #66046), DVA_DF (Addgene #66047), DVA_DG (Addgene #66048), DVA_DH (Addgene #66049), DVA_EB (Addgene #66050), DVA_EF (Addgene #66051), DVA_EG (Addgene #66052), DVA_EH (Addgene #66053), DVA_FB (Addgene #66054), DVA_GB (Addgene #66055), DVK (Addgene #66072), DVK_AE (Addgene #66067), DVK_AF (Addgene #66068), DVK_EF (Addgene #66069), DVK_FG (Addgene #66070), DVK_GH (Addgene #66071), E0030 (YFP)_CD (Addgene #66031), E0040m (GFP)_CD (Addgene #66032), E1010m (RFP)_CD (Addgene #66033), eBFP2 (eBFP2)_CD (Addgene #66034), I13453 (pBAD)_AB (Addgene #66016), I13453 (pBAD)_EB (Addgene #66017), I13453 (pBAD)_FB (Addgene #66018), I13453 (pBAD)_GB (Addgene #66019), J23100_AB (Addgene #65980), J23100_EB (Addgene #65981), J23100_FB (Addgene #65982), J23100_GB (Addgene #65983), J23102_AB (Addgene #65984), J23102_EB (Addgene #65985), J23102_FB (Addgene #65986), J23102_GB (Addgene #65987), J23103_AB (Addgene #65988), J23103_EB (Addgene #65989), J23103_FB (Addgene #65990), J23103_GB (Addgene #65991), J23106_AB (Addgene #65992), J23106_EB (Addgene #65993), J23106_FB (Addgene #65994), J23106_GB (Addgene #65995), J23107_AB (Addgene #65996), J23107_EB (Addgene #65997), J23107_FB (Addgene #65998), J23107_GB (Addgene #65999), J23116_AB (Addgene #66000), J23116_EB (Addgene #66001), J23116_FB (Addgene #66002), J23116_GB (Addgene #66003), pJ02B2Gm:Rm_AF (Addgene #66061), pJ02B2Gm_AE (Addgene #66057), pJ02B2Gm_AE (Addgene #66063), pJ02B2Gm_EF (Addgene #66058), pJ02B2Gm_EF (Addgene #66064), pJ02B2Rm:Gm_AF (Addgene #66062), pJ02B2Rm_AE (Addgene #66059), pJ02B2Rm_AE (Addgene #66065), pJ02B2Rm_EF (Addgene #66060), pJ02B2Rm_EF (Addgene #66066), R0010 (pLacI)_AB (Addgene #66004), R0010 (pLacI)_EB (Addgene #66005), R0010 (pLacI)_FB (Addgene #66006), R0010 (pLacI)_GB (Addgene #66007), R0040 (pTet)_AB (Addgene #66008), R0040 (pTet)_EB (Addgene #66009), R0040 (pTet)_FB (Addgene #66010), R0040 (pTet)_GB (Addgene #66011), R0063 (pLuxR-pR)_AB (Addgene #66012), R0063 (pLuxR-pR)_EB (Addgene #66013), R0063 (pLuxR-pR)_FB (Addgene #66014), R0063 (pLuxR-pR)_GB (Addgene #66015)

Proper citation: RRID:Addgene_1000000059 Copy   


https://www.addgene.org/pooled-library/zhang-human-sam-v1/

Vector Backbone Description: Vector Types:CRISPR, Lentiviral, Mammalian Expression
Comments: Human SAM library (Addgene #61597), lenti dCAS-VP64_Blast (Addgene #61425), lentiMPH v2 (Addgene #89308)

Proper citation: RRID:Addgene_1000000057 Copy   


  • RRID:Addgene_1000000021

https://www.addgene.org/kits/pertz-cpfret-biosensors/

Vector Backbone Description: Vector Types:Bacterial Expression, Insect Expression, Mammalian Expression
Comments: EKAR2G_design1_mTFP_105_Venus_157 (Addgene #39819), EKAR2G_design1_mTFP_105_Venus_173 (Addgene #39820), EKAR2G_design1_mTFP_105_Venus_195 (Addgene #39821), EKAR2G_design1_mTFP_105_Venus_229 (Addgene #39822), EKAR2G_design1_mTFP_105_Venus_wt (Addgene #39818), EKAR2G_design1_mTFP_159_Venus_157 (Addgene #39824), EKAR2G_design1_mTFP_159_Venus_173 (Addgene #39825), EKAR2G_design1_mTFP_159_Venus_195 (Addgene #39826), EKAR2G_design1_mTFP_159_Venus_229 (Addgene #39827), EKAR2G_design1_mTFP_159_Venus_wt (Addgene #39823), EKAR2G_design1_mTFP_175_Venus_157 (Addgene #39829), EKAR2G_design1_mTFP_175_Venus_173 (Addgene #39830), EKAR2G_design1_mTFP_175_Venus_195 (Addgene #39831), EKAR2G_design1_mTFP_175_Venus_229 (Addgene #39832), EKAR2G_design1_mTFP_175_Venus_wt (Addgene #39828), EKAR2G_design1_mTFP_227_Venus_157 (Addgene #39834), EKAR2G_design1_mTFP_227_Venus_173 (Addgene #39835), EKAR2G_design1_mTFP_227_Venus_195 (Addgene #39836), EKAR2G_design1_mTFP_227_Venus_229 (Addgene #39837), EKAR2G_design1_mTFP_227_Venus_wt (Addgene #39833), EKAR2G_design1_mTFP_wt_Venus_157 (Addgene #39814), EKAR2G_design1_mTFP_wt_Venus_173 (Addgene #39815), EKAR2G_design1_mTFP_wt_Venus_195 (Addgene #39816), EKAR2G_design1_mTFP_wt_Venus_229 (Addgene #39817), EKAR2G_design1_mTFP_wt_Venus_wt (Addgene #39813), EKAR2G_design2_mTFP_105_Venus_157 (Addgene #40000), EKAR2G_design2_mTFP_105_Venus_173 (Addgene #40001), EKAR2G_design2_mTFP_105_Venus_195 (Addgene #40002), EKAR2G_design2_mTFP_105_Venus_229 (Addgene #40003), EKAR2G_design2_mTFP_105_Venus_wt (Addgene #39999), EKAR2G_design2_mTFP_159_Venus_157 (Addgene #40005), EKAR2G_design2_mTFP_159_Venus_173 (Addgene #40006), EKAR2G_design2_mTFP_159_Venus_195 (Addgene #40007), EKAR2G_design2_mTFP_159_Venus_229 (Addgene #40008), EKAR2G_design2_mTFP_159_Venus_wt (Addgene #40004), EKAR2G_design2_mTFP_175_Venus_157 (Addgene #40010), EKAR2G_design2_mTFP_175_Venus_173 (Addgene #40011), EKAR2G_design2_mTFP_175_Venus_195 (Addgene #40012), EKAR2G_design2_mTFP_175_Venus_229 (Addgene #40013), EKAR2G_design2_mTFP_175_Venus_wt (Addgene #40009), EKAR2G_design2_mTFP_227_Venus_157 (Addgene #40015), EKAR2G_design2_mTFP_227_Venus_173 (Addgene #40016), EKAR2G_design2_mTFP_227_Venus_195 (Addgene #40017), EKAR2G_design2_mTFP_227_Venus_229 (Addgene #40018), EKAR2G_design2_mTFP_227_Venus_wt (Addgene #40014), EKAR2G_design2_mTFP_wt_Venus_157 (Addgene #39995), EKAR2G_design2_mTFP_wt_Venus_173 (Addgene #39996), EKAR2G_design2_mTFP_wt_Venus_195 (Addgene #39997), EKAR2G_design2_mTFP_wt_Venus_229 (Addgene #39998), EKAR2G_design2_mTFP_wt_Venus_wt (Addgene #39994)

Proper citation: RRID:Addgene_1000000021 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. SPARC Anatomical Working Group Resources

    Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within SPARC SAWG that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X