Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Apoptosis-inducing factor
Vector Backbone Description: Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Mammalian Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:16713569
Comments: Full-length human cDNAs were amplified using PCR primers and cloned into the pDONR223 "Donor" vector using the Gateway system as described (Rual et al., 2004), resulting in "Entry" clones. Reverse primers do not include stop codons. Forward primer: 5'-GGGGACAACTTTGTACAAAAAAGTTGGC ATGTTCCGGTGTGGAGGCC-3'. Reverse primer: 5'-GGGGACAACTTTGTACAAGAAAGTTGG GTCTTCATGAATGTTGAATAGTT-3'.
Proper citation: RRID:Addgene_16182 Copy
Species: Homo sapiens
Genetic Insert: PP2A regulatory subunit B, beta isoform
Vector Backbone Description: Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Mammalian Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:16713569
Comments: Full-length human cDNAs were amplified using PCR primers and cloned into the pDONR223 "Donor" vector using the Gateway system as described (Rual et al., 2004), resulting in "Entry" clones. Reverse primers do not include stop codons. Forward primer: 5'-GGGGACAACTTTGTACAAAAAAGTTGGC ATGGAGGAGGACATTGATACC-3'. Reverse primer: 5'-GGGGACAACTTTGTACAAGAAAGTTGG GTTAACCTTGTCCTGGAATATA-3'.
Proper citation: RRID:Addgene_16181 Copy
Species: Homo sapiens
Genetic Insert: PRKC gamma
Vector Backbone Description: Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Mammalian Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:16713569
Comments: Full-length human cDNAs were amplified using PCR primers and cloned into the pDONR223 "Donor" vector using the Gateway system as described (Rual et al., 2004), resulting in "Entry" clones. Reverse primers do not include stop codons. Forward primer: 5'-GGGGACAACTTTGTACAAAAAAGTTGGC ATGGCTGGTCTGGGCCCC-3'. Reverse primer: 5'-GGGGACAACTTTGTACAAGAAAGTTGG CATGACGGGCACAGGCACT-3'.
Proper citation: RRID:Addgene_16180 Copy
Species: Homo sapiens
Genetic Insert: KCNN1
Vector Backbone Description: Vector Backbone:pLX304; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_161693 Copy
Species: Mus musculus
Genetic Insert: Atg4B(C74A) (Atg4b Mouse)
Vector Backbone Description: Backbone Marker:Addgene #44012; Vector Backbone:pINDUCER20; Vector Types:Mammalian Expression, Lentiviral, destinatioin vector for gateway cloning; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32376951
Proper citation: RRID:Addgene_161735 Copy
Species: Other
Genetic Insert: Surface marker and Citrine repression reporter
Vector Backbone Description: Vector Backbone:pAAVS1 donor; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33326746
Comments: Cloned with reagents shared by and in collaboration with Michael Bassik.
Proper citation: RRID:Addgene_161927 Copy
Vector Backbone Description: Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24395366
Proper citation: RRID:Addgene_161886 Copy
Vector Backbone Description: Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24395366
Proper citation: RRID:Addgene_161889 Copy
Species: Homo sapiens
Genetic Insert: INPP5D
Vector Backbone Description: Vector Backbone:eGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30487552
Proper citation: RRID:Addgene_161998 Copy
Species: Synthetic
Genetic Insert: mGreenLantern
Vector Backbone Description: Backbone Size:5410; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33208539
Proper citation: RRID:Addgene_161912 Copy
Species: Drosophila melanogaster
Genetic Insert: Drosophila melanogaster Shaker cognate l
Vector Backbone Description: Backbone Size:3200; Vector Backbone:pBSc; Vector Types:Xenopus Oocyte expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2333511
Proper citation: RRID:Addgene_16196 Copy
Vector Backbone Description: Backbone Size:16255; Vector Backbone:pHEE401E; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_161933 Copy
Species: Caenorhabditis elegans
Genetic Insert: Caenorhabditis elegans SLOwpoke potassium channel
Vector Backbone Description: Backbone Size:3200; Vector Backbone:pOX; Vector Types:Xenopus Oocyte expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10903569
Proper citation: RRID:Addgene_16202 Copy
Vector Backbone Description: Backbone Size:6696; Vector Backbone:pMSR0; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:33247281
Comments: Please note Addgene NGS result identified a mismatch in pBP1_RepA. Depositor has not confirmed if this is a concern for plasmid function. We recommend additional QC to confirm plasmid is functional.
Proper citation: RRID:Addgene_161984 Copy
Species: Homo sapiens
Genetic Insert: PH-TAPP1
Vector Backbone Description: Vector Backbone:eGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23823722
Proper citation: RRID:Addgene_161985 Copy
Species: Homo sapiens
Genetic Insert: PIK3C2B
Vector Backbone Description: Vector Backbone:eGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28572395
Comments: This plasmid has also been described in: Wallroth, A., Koch, P.A., Marat, A.L., Krause, E., Haucke, V. (2019) Protein kinase N controls a lysosomal lipid switch to facilitate nutrient signaling via mTORC1. Nature Cell Biol. 21, 1093-1101. doi: 10.1038/s41556-019-0377-3
Proper citation: RRID:Addgene_161989 Copy
Species: Synthetic
Genetic Insert: natR412 guide
Vector Backbone Description: Backbone Size:11240; Vector Backbone:pML104; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34042294
Comments: This plasmid is derived from Addgene plasmid #67638 pML104 (deposited by John Wyrick) with an inserted guide sequence using the BclI-SwaII restriction sites.
Guide sequence: GTACCGCACCAGTGTCCCGG
Proper citation: RRID:Addgene_162042 Copy
Species: Synthetic
Genetic Insert: hSpCas9
Vector Backbone Description: Backbone Marker:Drosophila Genomics Resource Center; Vector Backbone:pHW; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33436886
Comments: https://www.biorxiv.org/content/10.1101/2020.10.09.333641v1
Proper citation: RRID:Addgene_162163 Copy
Species: Synthetic
Genetic Insert: kanR468 guide
Vector Backbone Description: Backbone Size:12367; Vector Backbone:pML107; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34042294
Comments: This plasmid is derived from Addgene plasmid #67639 pML107 (deposited by John Wyrick) with an inserted guide sequence using the BclI-SwaII restriction sites.
Guide sequence: TCCATGTTGGAATTTAATCG
Proper citation: RRID:Addgene_162041 Copy
Species: Synthetic
Genetic Insert: hSpCas9
Vector Backbone Description: Backbone Marker:Drosophila Genomics Resource Center; Vector Backbone:pHW; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33436886
Comments: https://www.biorxiv.org/content/10.1101/2020.10.09.333641v1
Proper citation: RRID:Addgene_162161 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within SPARC SAWG that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
