Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/127171
Proper Citation: RRID:Addgene_127171
Insert Name: Frameshift Reporter
Organism: Mammalian
Bacterial Resistance: Ampicillin
Defining Citation: PMID:31626775
Vector Backbone Description: Vector Backbone:pHR (Addgene #67928); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Comments: Cloning Site 3-prime: CCACATAGCGTAAAAGGAGC Please visit https://www.biorxiv.org/content/10.1101/383943v1 for bioRxiv preprint.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pL_FR_Hygro.
No alerts have been found for pL_FR_Hygro.
Source: Addgene