Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/254898
Proper Citation: RRID:Addgene_254898
Insert Name: Carries a single chromosomal copy of the repressor TetR downstream of PcpcG2 promoter inserted in nupG locus
Bacterial Resistance: None
Defining Citation: PMID:41996246
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Comments: For validation, use primers: FWD: CGTGAGCGGTAAAGTTGTTG and REV: CGGAGCTGCAAGGTGTTTATAG flanking the nupG locus to verify gene insertion. Please visit https://doi.org/10.1101/2024.11.27.625634 for bioRxiv preprint.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for E. coli BW25113:PcpcG2-tetR (CMB247).
No alerts have been found for E. coli BW25113:PcpcG2-tetR (CMB247).
Source: Addgene
