Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
RG3004 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033334 | Caenorhabditis elegans | sra-4(ve504[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1294 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ggtgtgaaagattttaaataaacaccctcg ; Right flanking sequence: CAAGGACATtctttaaaagtaaaaagaacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1294 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ggtgtgaaagattttaaataaacaccctcg ; Right flanking sequence: CAAGGACATtctttaaaagtaaaaagaacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Emily Lorenz-Mueller"|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-4. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ggtgtgaaagattttaaataaacaccctcg Right flanking sequence: CAAGGACATtctttaaaagtaaaaagaacc" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005030(sra-4)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005030(sra-4), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033334 | WormBase (WB) | WB | available | WB-STRAIN:RG3004, CGC_RG3004 | 2026-08-08 10:14:32 | 0 | |||
|
RG3006 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033335 | Caenorhabditis elegans | sra-31(ve506[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1008 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gttttattttttaaatacCGTCATAAAAGC ; Right flanking sequence: CCAGGAATTTCCATtttagctgatatagat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1008 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: gttttattttttaaatacCGTCATAAAAGC ; Right flanking sequence: CCAGGAATTTCCATtttagctgatatagat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-31. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005057(sra-31)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005057(sra-31), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033335 | WormBase (WB) | WB | available | WB-STRAIN:RG3006, CGC_RG3006 | 2026-08-08 10:14:32 | 0 | |||
|
RP1 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033417 | Caenorhabditis elegans | trIs10. | Made_by: S Dixon / P Roy|"trIs10 [myo-3p::MB::YFP + myo-2p::YFP + ceh-23::HcRed + unc-25::DsRed + unc-129nsp::CFP]." | WBGene00000446(ceh-23)|WBGene00003514(myo-2)|WBGene00003515(myo-3)|WBGene00006762(unc-25)|WBGene00006852(unc-129) | WBGene00000446(ceh-23), WBGene00003514(myo-2), WBGene00003515(myo-3), WBGene00006762(unc-25), WBGene00006852(unc-129) | WB-STRAIN:WBStrain00033417 | WormBase (WB) | WB | available | WB-STRAIN:RP1, CGC_RP1 | 2026-08-08 10:14:33 | 0 | |||
|
VC307 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035666 | Caenorhabditis elegans | kin-1(ok338)/mIs13 I. | Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK909.2a. mIs13 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] I. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP (stronger signal represents mIs13 homozygotes, weaker signal represents ok338/mIs13) and non-GFP ok338 homozygotes (arrested embryos). Pick dim GFP WT and check for correct segregation of progeny to maintain." | WBGene00002189(kin-1)|WBGene00003514(myo-2)|WBGene00003983(pes-10) | WBGene00002189(kin-1), WBGene00003514(myo-2), WBGene00003983(pes-10) | WB-STRAIN:WBStrain00035666 | WormBase (WB) | WB | available | WB-STRAIN:VC307, CGC_VC307 | 2026-08-08 10:15:06 | 0 | |||
|
MV1 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027638 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00003514(myo-2) | WBGene00003514(myo-2) | WB-STRAIN:WBStrain00027638 | WormBase (WB) | WB | unknown | WB-STRAIN:MV1 | 2026-08-08 10:13:15 | 0 | |||
|
OK39 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00029941 | Caenorhabditis elegans | cuIs2 IV. | cuIs2 [myo-2c:: GFP + rol-6(su1006)]. Rollers.|"Made_by: Christina Haun"|"Mutagen:Gamma rays"|"Supplementary_genotype Myo-2c" | WBGene00003514(myo-2) | WBGene00003514(myo-2) | WB-STRAIN:WBStrain00029941 | WormBase (WB) | WB | available | PMID:37957360 | WB-STRAIN:OK39, CGC_OK39 | 2026-08-08 10:13:49 | 1 | ||
|
PD4793 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00030592 | Caenorhabditis elegans | mIs10 V. | mIs10 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] V. WT GFP phenotype, with expression in 4-cell embryos, pharyngeal muscle and gut. Strong GFP signal. Suppresses recombination between unc-60 and dpy-11. See WBG 15 #5 page 20. | WBGene00003514(myo-2)|WBGene00003983(pes-10)|WBGene00017698(F22B7.9) | WBGene00003514(myo-2), WBGene00003983(pes-10), WBGene00017698(F22B7.9) | WB-STRAIN:WBStrain00030592 | WormBase (WB) | WB | available | PMID:32434424 PMID:37067863 |
WB-STRAIN:PD4793, CGC_PD4793 | 2026-08-08 10:13:57 | 2 | ||
|
PD4790 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00030590 | Caenorhabditis elegans | mIs12 II. | mIs12 [myo-2p::GFP + pes-10p::GFP + F22B7.9::GFP] II. Hermaphrodites expressing compound GFP reporter (see PD4790). Strong pharyngeal muscle expression, easily scored by GFP dissecting scope. mIs12 is tightly linked to unc-4 II, and not to LG III or IV as previously reported. mIs12 homozygous males mate well (ME3). See WBG 15 #5 page 20. See CB5584. | WBGene00003514(myo-2)|WBGene00003983(pes-10)|WBGene00017698(F22B7.9) | WBGene00003514(myo-2), WBGene00003983(pes-10), WBGene00017698(F22B7.9) | WB-STRAIN:WBStrain00030590 | WormBase (WB) | WB | available | PMID:38564369 | WB-STRAIN:PD4790, CGC_PD4790 | 2026-08-08 10:13:58 | 0 | ||
|
OH4605 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029468 | Caenorhabditis elegans | unc-37(ot59)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); him-8(e1489) IV; otIs3 V. | Heterozygotes are WT and GFP+ in the pharynx. ot59 is homozygous inviable. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. otIs3[lin-15(+) + gcy-7::GFP]. otIs3 is expressed in ASEL in WT animals. In this ot59 strain, otIs3 is expressed in ASEL and ASER. | WBGene00000254(bli-4)|WBGene00001534(gcy-7)|WBGene00001578(ges-1)|WBGene00001867(him-8)|WBGene00003514(myo-2)|WBGene00003983(pes-10)|WBGene00006773(unc-37) | WBGene00000254(bli-4), WBGene00001534(gcy-7), WBGene00001578(ges-1), WBGene00001867(him-8), WBGene00003514(myo-2), WBGene00003983(pes-10), WBGene00006773(unc-37) | WB-STRAIN:WBStrain00029468 | WormBase (WB) | WB | available | WB-STRAIN:OH4605, CGC_OH4605 | 2026-08-08 10:13:43 | 0 | |||
|
OH7116 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029503 | Caenorhabditis elegans | lsy-22(ot114) unc-101(m1) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); otIs3 V. | Made_by: Eileen Flowers|"otIs3 [gcy-7::GFP + lin-15(+)]. qIs48 [myo-2::GFP + pes-10::GFP + ges-1::GFP]. Homozygous hT2 animals are inviable. Heterozygotes are WT and GFP+. Homozygous lsy-22(ot114) unc-101(m1) animals are Unc and have a maternal effect embryonic lethal phenotype. Whole genome sequenced strain." | WBGene00000254(bli-4)|WBGene00001534(gcy-7)|WBGene00001578(ges-1)|WBGene00003514(myo-2)|WBGene00003983(pes-10)|WBGene00006829(unc-101)|WBGene00009188(lsy-22) | WBGene00000254(bli-4), WBGene00001534(gcy-7), WBGene00001578(ges-1), WBGene00003514(myo-2), WBGene00003983(pes-10), WBGene00006829(unc-101), WBGene00009188(lsy-22) | WB-STRAIN:WBStrain00029503 | WormBase (WB) | WB | available | PMID:20439776 | WB-STRAIN:OH7116, CGC_OH7116 | 2026-08-08 10:13:46 | 0 | ||
|
VC3986 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037868 | Caenorhabditis elegans | Y18D10A.9(gk5013[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hIn1[unc-101(sy241)] I . | Made_by: Vancouver KO Group|"Recessive lethal deletion balanced by hIn1. Deletion of 4986 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGAAAATTTCGGATTCGGGTTCCATGCCA; Right flanking sequence: GTCTGAAAATTGAAAATAAATTTAAAAACT. See WormBase Variation gk5013 for details." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00006829(unc-101) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00006829(unc-101) | WB-STRAIN:WBStrain00037868 | WormBase (WB) | WB | available | WB-STRAIN:VC3986, CGC_VC3986 | 2026-08-08 10:15:37 | 0 | |||
|
VC4064 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037901 | Caenorhabditis elegans | ceh-54(gk5138[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. | Homozygous viable. Deletion of 3125 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTATTCTGGAAATCGGCAAAAAACCAGTT ; Right flanking sequence: GTATAGATAATGCGCTTATTCAAAGTGAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00020485(ceh-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00020485(ceh-54) | WB-STRAIN:WBStrain00037901 | WormBase (WB) | WB | available | WB-STRAIN:VC4064, CGC_VC4064 | 2026-08-08 10:15:37 | 0 | |||
|
VC3988 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037869 | Caenorhabditis elegans | H04D03.3(gk5060[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. | Homozygous viable. Deletion of 2070 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTCCGATTTAAAACTGTCTCTTCCTCTA; Right flanking sequence: CTGGTCATGTTTTTCGAATATTCCACAATT. See WormBase Variation gk5060 for details.|"Made_by: Vancouver KO Group"|"Supplementary_genotype (H04D03.3(gk5060 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP]) III)" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00037869 | WormBase (WB) | WB | available | PMID:37355092 | WB-STRAIN:VC3988, CGC_VC3988 | 2026-08-08 10:15:37 | 0 | ||
|
VC3975 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037863 | Caenorhabditis elegans | +/nT1 IV; sas-5(gk5038[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 V. | Made_by: Vancouver KO Group|"Recessive lethal deletion balanced by nT1. Deletion of 1442 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCAGCTTCCACAAGAAAGGACAAAACCCC; Right flanking sequence: GGTACCTGAGACTCCAGCTGAACGAGAACG. See WormBase Variation gk5038 for details." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00009385(sas-5) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00009385(sas-5) | WB-STRAIN:WBStrain00037863 | WormBase (WB) | WB | available | WB-STRAIN:VC3975, CGC_VC3975 | 2026-08-08 10:15:37 | 0 | |||
|
VC3967 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037860 | Caenorhabditis elegans | Y69A2AR.32(gk5043[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 1554 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCGAAACAATGATAATTATCACGATCAAC; Right flanking sequence: CTGATGTCCACTCCGATGCCGCCTCCAGGA. See WormBase Variation gk5043 for details.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00037860 | WormBase (WB) | WB | available | WB-STRAIN:VC3967, CGC_VC3967 | 2026-08-08 10:15:37 | 0 | |||
|
VC3973 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037861 | Caenorhabditis elegans | zipt-13(gk5051[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. | Homozygous viable. Deletion of 2219 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCTGTCAGAGCAATGTTGAGAAATCCTCCT; Right flanking sequence: GTCCTTGTTGAGCATGTATCGCAATGCAAG. See WormBase Variation gk5051 for details.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00007591(zipt-13) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00007591(zipt-13) | WB-STRAIN:WBStrain00037861 | WormBase (WB) | WB | available | WB-STRAIN:VC3973, CGC_VC3973 | 2026-08-08 10:15:37 | 0 | |||
|
VC3983 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037866 | Caenorhabditis elegans | mrps-26(gk5010[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/qC1[dpy-19(e1259) glp-1(q339)] III. | Made_by: Vancouver KO Group|"Recessive lethal deletion balanced by qC1. Deletion of 993 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGGACGATGTCTTTTGGCATCTGCCATGTC; Right flanking sequence: GGACATGATGTGAGTTATTTTTGAACATCG. See WormBase Variation gk5010 for details." | WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00016412(mrps-26) | WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00016412(mrps-26) | WB-STRAIN:WBStrain00037866 | WormBase (WB) | WB | available | WB-STRAIN:VC3983, CGC_VC3983 | 2026-08-08 10:15:37 | 0 | |||
|
VC4060 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037900 | Caenorhabditis elegans | ech-1.1(gk5134[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. | Homozygous viable. Deletion of 2429 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATTGGTTTTAGCTATAAAATTGTCCTCCA ; Right flanking sequence: TGCGGTAGTGACAAGCAAGGGCGATTTCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00037900 | WormBase (WB) | WB | available | WB-STRAIN:VC4060, CGC_VC4060 | 2026-08-08 10:15:37 | 0 | |||
|
VC3981 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037865 | Caenorhabditis elegans | F59G1.4(gk5058[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 1769 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACTACAATAGAGTTCCACTAACGCCAACT; Right flanking sequence: TTTGGTAATTTGCCAAAATTCGACGGTCAT. See WormBase Variation gk5058 for details.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00037865 | WormBase (WB) | WB | available | PMID:38302462 | WB-STRAIN:VC3981, CGC_VC3981 | 2026-08-08 10:15:37 | 0 | ||
|
VC4018 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037879 | Caenorhabditis elegans | ZK616.1(gk5090[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 2060 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACATTTATTCCTGTTTCACTACATCATGAT ; Right flanking sequence: ACACTCCGTTTTGAACGTAGAAAAGTGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00037879 | WormBase (WB) | WB | available | WB-STRAIN:VC4018, CGC_VC4018 | 2026-08-08 10:15:37 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
