Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
The record is no longer available at this source.
Source Database: RGD, Rat Genome Database Strain List RGD
Genetic Background: mutant
Affected Genes: (null)
Genomic Alteration: (null)
Availability: Not Available
Source References: (null)
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Tert gene of Crl:SD rat embryos. The resulting mutation is a 17-bp deletion of exon1 in Tert gene. MCW Gene Editing Rat Resource Center This is a legacy resource.
Proper citation: RRID:RGD_13207522 Copy
The record is no longer available at this source.
Source Database: RGD, Rat Genome Database Strain List RGD
Genetic Background: mutant
Affected Genes: (null)
Genomic Alteration: (null)
Availability: Not Available
Source References: (null)
Notes: The CRISPR/Cas9 genome editing system was used to generate this mutant rat strain. It inserted 55-79 copies of human premutation CGG repeats of the FMR1 gene into rat Fmr1. The recipient zygotes were from inbred strain F344 at RRRC. Rat Resource and Research Center This is a legacy resource.
Proper citation: RRID:RGD_11537344 Copy
The record is no longer available at this source.
Source Database: RGD, Rat Genome Database Strain List RGD
Genetic Background: mutant
Affected Genes: (null)
Genomic Alteration: (null)
Availability: Not Available
Source References: (null)
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in Exon 2 of the Avpr2 gene. MCW Gene Editing Rat Resource Center This is a legacy resource.
Proper citation: RRID:RGD_13208586 Copy
The record is no longer available at this source.
Source Database: RGD, Rat Genome Database Strain List RGD
Genetic Background: mutant
Affected Genes: (null)
Genomic Alteration: (null)
Availability: Not Available
Source References: (null)
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in Exon 2 of the Avpr2 gene. MCW Gene Editing Rat Resource Center This is a legacy resource.
Proper citation: RRID:RGD_13208585 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=401900746
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-11-21)
Alternate IDs: RGD_401900746
Notes: CRISPR/Cas9 system was used to introduce Cre recombinase downstream of the Prl7b1 start site. Rat Resource and Research Center
Proper citation: 001013 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=616335891
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-05-13)
Alternate IDs: RGD_616335891
Notes: Exons 2 and 3 were deleted to eliminate all known Synaptopodin isoforms in the outbred Long Evans (Charles River 006). It is similar to RRRC strain #964 (LE-Synpoem1Kmh) (RGD:155782907), has a different mutation location upstream of exon 2. This strain is deposited at Rat Resource and Research Center
Proper citation: 001025 Copy
http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=401827145
Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Availability: Cryorecovery (as of 2025-01-27)
Alternate IDs: RGD_401827145
Notes: The CRISPR-Cas9 system was used to delete the coding region (exons 1-8) of the Pink1 gene in NTac:SD embryos. The rat is deposited at Rat Resource and Research Center (RRRC).
Rat Resource and Research Center
Proper citation: 001007 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10002787
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10002787
Notes: Several rats curled arose spontaneously in a closed colony of SD rats maintained at Laboratory Animal Center of Zhengzhou University. a 3 bp deletion at position 420-422 of Krt71 which results in the deletion of aspartate was identified.
Proper citation: RRID:RGD_10002787 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10002791
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 10002791
Notes: This strain was produced by injecting TALENs targeting the sequence CTCAGTGTTCCTACTCTgcccctcccagaggttcaATGCTTTGTGTTCAATGTCG into Crl:SD rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 3. Availability contact: [email protected]
Proper citation: RRID:RGD_10002791 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054414
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 10054414
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Mmp9 gene of SS/JrHsdMcwi rat embryos. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_10054414 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=61113
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 61113
Notes: These were derived by introgressing mutant Lx gene of the polydactylous rat onto the BN background.
Proper citation: RRID:RGD_61113 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10053598
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10053598
Notes: Foxn1 mutation was induced by injecting pX330 expressing Cas9 and sgRNA targeting the sequence GACTGGAGGGCGAACCCCAA into Crlj:WI rat embryos. The resulting mutation is a 44-bp frameshift deletion in exon 1 (del 54-97). Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN
Proper citation: RRID:RGD_10053598 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10047085
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10047085
Notes: CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+Oligo was injected into zygote of SD rat. The mutation changed the 521th amino acid Arg (R) into Cys (C). Institute of Neuroscience, Chinese Academy of Sciences
Proper citation: RRID:RGD_10047085 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054386
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2018-11-26)
Alternate IDs: 10054386
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Chrna5 gene of LEW/NCrl rat embryos. The resulting mutation is a 1-bp insertion in the Chrna5 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_10054386 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054383
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2018-11-26)
Alternate IDs: 10054383
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Chrna4 gene of LEW/NCrl rat embryos. The resulting mutation is a 16-bp deletion in the Chrna4 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_10054383 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054398
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Sperm (as of 2018-10-22)
Alternate IDs: 10054398
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Gla gene of DA/OlaHsd rat embryos. The resulting mutation is a 47-bp deletion in the Gla gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_10054398 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054401
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Sperm (as of 2018-10-22)
Alternate IDs: 10054401
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Helz2 gene of FHH-Chr 3BN/Mcwi rat embryos.The resulting mutation is a 11-bp deletion in the Helz2 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_10054401 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054376
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2018-11-26)
Alternate IDs: 10054376
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Chrna3 gene of LEW/NCrl rat embryos. The resulting mutation is a 17-bp deletion in the Chrna3 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_10054376 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054296
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2018-10-22)
Alternate IDs: 10054296
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Arhgef11 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in the Arhgef11 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_10054296 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054453
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 10054453
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in the Sirt3 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_10054453 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.