Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00035587
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00010510(ent-3)
Genomic Alteration: WBGene00010510(ent-3)
Availability: available
References:
Synonyms: ent-3(gk158) V.
Alternate IDs: WB-STRAIN:VC211, CGC_VC211
Notes: K02E11.1. Superficially wild type.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035587 Copy
http://www.wormbase.org/db/get?name=WBStrain00035590
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006409(hdl-2)
Genomic Alteration: WBGene00006409(hdl-2)
Availability: available
References:
Synonyms: hdl-2(ok440) IV.
Alternate IDs: WB-STRAIN:VC217, CGC_VC217
Notes: C09G9.4. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035590 Copy
http://www.wormbase.org/db/get?name=WBStrain00035593
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000553(cmk-1)|WBGene00044213(Y102A5C.36)
Genomic Alteration: WBGene00000553(cmk-1), WBGene00044213(Y102A5C.36)
Availability: available
References:
Synonyms: cmk-1(ok287) IV; gkDf56 Y102A5C.36(gk3558) V.
Alternate IDs: WB-STRAIN:VC220, CGC_VC220
Notes: Mutagen:UV/TMP|"This strain is homozygous for a deletion (ok287) in K07A9.2, detectable by PCR using the following primers. External left primer: CAGTGCCTTTAGGGCTTGAG. External right primer: GGGGTACTGTGGCTGAAAAA. Internal left primer: TAAATCAAACGCCCTTGGAA. Internal right primer: AAACGAAAACCCGGAGAAAT. Internal WT amplicon: 2970 bp. Deletion size: 1921 bp. Deletion left flank: TGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCT AGGATCTGGGGTAGGCCTAGGATC. Deletion right flank: GAAATACGGCGTACACACACGATATTCACG. Validation: ok287 passed by CGH. Other deletions (gkDf56 and gk3558) identified by CGH."|"This strain is homozygous for a deletion (ok287) in K07A9.2, detectable by PCR using the following primers. External left primer: CAGTGCCTTTAGGGCTTGAG. External right primer: GGGGTACTGTGGCTGAAAAA. Internal left primer: TAAATCAAACGCCCTTGGAA. Internal right primer: AAACGAAAACCCGGAGAAAT. Internal WT amplicon: 2970 bp. Deletion size: 1921 bp. Deletion left flank: TGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATC. Deletion right flank: GAAATACGGCGTACACACACGATATTCACG. Validation: ok287 passed by CGH. Other deletions (gkDf56 and gk3558) identified by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035593 Copy
http://www.wormbase.org/db/get?name=WBStrain00035519
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006876(vab-10)
Genomic Alteration: WBGene00006876(vab-10)
Availability: available
References:
Synonyms: vab-10(gk45) I.
Alternate IDs: WB-STRAIN:VC117, CGC_VC117
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK1151.1a. Superficially wild type."
Proper citation: RRID:WB-STRAIN:WBStrain00035519 Copy
http://www.wormbase.org/db/get?name=WBStrain00035596
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006411(octr-1)
Genomic Alteration: WBGene00006411(octr-1)
Availability: available
References:
Synonyms: octr-1(ok371) X.
Alternate IDs: WB-STRAIN:VC224, CGC_VC224
Notes: F14D12.6. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035596 Copy
http://www.wormbase.org/db/get?name=WBStrain00035511
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000145(apc-11)
Genomic Alteration: WBGene00000145(apc-11)
Availability: available
References:
Synonyms: apc-11(gk37)/eT1 III; +/eT1 V.
Alternate IDs: WB-STRAIN:VC109, CGC_VC109
Notes: F35G12.9. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and sterile homozygous gk37 hermaphrodites. Pick WT hermaphrodites and check for correct segregation of progeny to maintain.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035511 Copy
http://www.wormbase.org/db/get?name=WBStrain00035510
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: available
References:
Synonyms: H32C10(gk36) IV.
Alternate IDs: WB-STRAIN:VC108, CGC_VC108
Notes: H32C10. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035510 Copy
http://www.wormbase.org/db/get?name=WBStrain00035598
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00002048(ida-1)
Genomic Alteration: WBGene00002048(ida-1)
Availability: available
References:
Synonyms: ida-1(ok409) III.
Alternate IDs: WB-STRAIN:VC226, CGC_VC226
Notes: B0244.2. Slow-growing, and some animals appear sterile or Egl. Tail defects are common, and hermaphrodites can be mistaken for males in extreme cases.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035598 Copy
http://www.wormbase.org/db/get?name=WBStrain00035512
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00004248(pus-1)
Genomic Alteration: WBGene00004248(pus-1)
Availability: available
References:
Synonyms: pus-1(gk38) V.
Alternate IDs: WB-STRAIN:VC110, CGC_VC110
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W06H3.2. Superficially wild type."
Proper citation: RRID:WB-STRAIN:WBStrain00035512 Copy
http://www.wormbase.org/db/get?name=WBStrain00035602
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001687(gpn-1)
Genomic Alteration: WBGene00001687(gpn-1)
Availability: available
References:
Synonyms: gpn-1(ok377) X.
Alternate IDs: WB-STRAIN:VC233, CGC_VC233
Notes: F59D12.4. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035602 Copy
http://www.wormbase.org/db/get?name=WBStrain00035605
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001309(emr-1)
Genomic Alteration: WBGene00001309(emr-1)
Availability: available
References:
Synonyms: emr-1(gk119) I.
Alternate IDs: WB-STRAIN:VC237, CGC_VC237
Notes: M01D7.6. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035605 Copy
http://www.wormbase.org/db/get?name=WBStrain00035604
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001072(dpy-10)|WBGene00003915(pan-1)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00003915(pan-1)
Availability: available
References:
Synonyms: +/mT1 II; pan-1(gk142)/mT1 [dpy-10(e128)] III.
Alternate IDs: WB-STRAIN:VC235, CGC_VC235
Notes: M88.6a. Heterozygotes are WT and segregate WT, arrested mT1 aneuploid progeny, sterile Dpy-10 mT1 homozygotes, and homozygous gk142 hermaphrodites (dpyish L1 or L2 larvae). Pick WT hermaphrodites and check for correct segregation of progeny to maintain.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035604 Copy
http://www.wormbase.org/db/get?name=WBStrain00035606
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006308(sul-1)
Genomic Alteration: WBGene00006308(sul-1)
Availability: available
References:
Synonyms: sul-1(gk151) X.
Alternate IDs: WB-STRAIN:VC238, CGC_VC238
Notes: K09C4.8. Superficially wild type.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035606 Copy
http://www.wormbase.org/db/get?name=WBStrain00035609
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001435(fkh-3)
Genomic Alteration: WBGene00001435(fkh-3)
Availability: available
References:
Synonyms: fkh-3(ok455) X.
Alternate IDs: WB-STRAIN:VC241, CGC_VC241
Notes: C29F7.4. Superficially wild type.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035609 Copy
http://www.wormbase.org/db/get?name=WBStrain00035682
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003275(mir-47)
Genomic Alteration: WBGene00003275(mir-47)
Availability: available
References:
Synonyms: mir-47(gk167) X.
Alternate IDs: WB-STRAIN:VC328, CGC_VC328
Notes: K02B9.5. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035682 Copy
http://www.wormbase.org/db/get?name=WBStrain00035685
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: available
References:
Synonyms: F53B6(gk201) I.
Alternate IDs: WB-STRAIN:VC332, CGC_VC332
Notes: F53B6. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035685 Copy
http://www.wormbase.org/db/get?name=WBStrain00035687
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00002043(hyl-1)
Genomic Alteration: WBGene00002043(hyl-1)
Availability: available
References:
Synonyms: hyl-1(gk203) IV.
Alternate IDs: WB-STRAIN:VC334, CGC_VC334
Notes: C09G4.1. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035687 Copy
http://www.wormbase.org/db/get?name=WBStrain00035689
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001072(dpy-10)|WBGene00001527(gcs-1)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00001527(gcs-1)
Availability: available
References:
Synonyms: gcs-1(ok436)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:VC337, CGC_VC337
Notes: F37B12.2. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and GFP- ok436 homozygotes (approximately L2 arrest). Pick WT and check for correct segregation of progeny to maintain.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035689 Copy
http://www.wormbase.org/db/get?name=WBStrain00035688
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001627(gly-2)
Genomic Alteration: WBGene00001627(gly-2)
Availability: available
References:
Synonyms: gly-2(gk204) I.
Alternate IDs: WB-STRAIN:VC335, CGC_VC335
Notes: C55B7.2. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035688 Copy
http://www.wormbase.org/db/get?name=WBStrain00035692
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001072(dpy-10)|WBGene00001840(hel-1)|WBGene00006787(unc-52)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00001840(hel-1), WBGene00006787(unc-52)
Availability: available
References:
Synonyms: hel-1(gk191)/mnC1 [dpy-10(e128) unc-52(e444)] II.
Alternate IDs: WB-STRAIN:VC341, CGC_VC341
Notes: C26D10.2. Heterozygotes are WT and segregate WT, paralyzed Dpy mnC1 homozygotes and gk191 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00035692 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
