Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
VC165 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035550 | Caenorhabditis elegans | ttn-1(gk135) V. | H05O09.1 W06H8.8 Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006436(ttn-1) | WBGene00006436(ttn-1) | WB-STRAIN:WBStrain00035550 | WormBase (WB) | WB | available | WB-STRAIN:VC165, CGC_VC165 | 2026-07-25 10:24:00 | 0 | |||
|
VC168 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035553 | Caenorhabditis elegans | ppt-1(gk134) V. | F44C4.5. Dpyish.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00004092(ppt-1) | WBGene00004092(ppt-1) | WB-STRAIN:WBStrain00035553 | WormBase (WB) | WB | available | WB-STRAIN:VC168, CGC_VC168 | 2026-07-25 10:24:00 | 0 | |||
|
VC170 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035555 | Caenorhabditis elegans | cki-1(gk132)/mIn1 II | Mutagen:UV/TMP|"T05A6.1. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and gk132 homozygotes (embryonic arrest). Pick WT and check for correct segregation of progeny to maintain."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000516(cki-1)|WBGene00001072(dpy-10) | WBGene00000516(cki-1), WBGene00001072(dpy-10) | WB-STRAIN:WBStrain00035555 | WormBase (WB) | WB | available | PMID:38522217 | WB-STRAIN:VC170, CGC_VC170 | 2026-07-25 10:23:59 | 0 | ||
|
VC169 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035554 | Caenorhabditis elegans | tbb-2(gk129) III. | C36E8.5. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006537(tbb-2) | WBGene00006537(tbb-2) | WB-STRAIN:WBStrain00035554 | WormBase (WB) | WB | available | WB-STRAIN:VC169, CGC_VC169 | 2026-07-25 10:24:00 | 0 | |||
|
VC172 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035557 | Caenorhabditis elegans | cep-1(gk138) I. | F52B5.5. Superficially wild type.|"Reference WBPaper00058832 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00060693 added based on published strain data identified by Textpresso literature search."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000467(cep-1) | WBGene00000467(cep-1) | WB-STRAIN:WBStrain00035557 | WormBase (WB) | WB | available | PMID:31704915 PMID:33262405 |
WB-STRAIN:VC172, CGC_VC172 | 2026-07-25 10:24:01 | 0 | ||
|
VC171 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00035556 | Caenorhabditis elegans | smf-2(gk133) X. | K11G12.3. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00004877(smf-2) | WBGene00004877(smf-2) | WB-STRAIN:WBStrain00035556 | WormBase (WB) | WB | available | WB-STRAIN:VC171, CGC_VC171 | 2026-07-25 10:24:00 | 1 | |||
|
VC175 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035560 | Caenorhabditis elegans | sod-4(gk101) III. | F55H2.1. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00004933(sod-4) | WBGene00004933(sod-4) | WB-STRAIN:WBStrain00035560 | WormBase (WB) | WB | available | WB-STRAIN:VC175, CGC_VC175 | 2026-07-25 10:24:01 | 0 | |||
|
VC128 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035525 | Caenorhabditis elegans | mtl-2(gk125) V. | Mutagen:UV/TMP|"T08G5.10. Superficially wild type."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003474(mtl-2) | WBGene00003474(mtl-2) | WB-STRAIN:WBStrain00035525 | WormBase (WB) | WB | available | PMID:38790689 | WB-STRAIN:VC128, CGC_VC128 | 2026-07-25 10:23:59 | 0 | ||
|
VC133 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035529 | Caenorhabditis elegans | C05D11.8(gk47) III. | C05D11.8. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00015485(fhip-1) | WBGene00015485(fhip-1) | WB-STRAIN:WBStrain00035529 | WormBase (WB) | WB | available | WB-STRAIN:VC133, CGC_VC133 | 2026-07-25 10:23:59 | 0 | |||
|
VC118 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035520 | Caenorhabditis elegans | haf-7(gk46) V. | Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y50E8A.16. Superficially wild type." | WBGene00001817(haf-7) | WBGene00001817(haf-7) | WB-STRAIN:WBStrain00035520 | WormBase (WB) | WB | available | WB-STRAIN:VC118, CGC_VC118 | 2026-07-25 10:23:59 | 0 | |||
|
VC125 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035522 | Caenorhabditis elegans | tyra-3(ok325) X. | M03F4.3. Superficially wild type.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"Supplementary_genotype tyra-3(ok325)"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain provided so WBPaper00060134 paper added based on AFP_Strain data." | WBGene00006475(tyra-3) | WBGene00006475(tyra-3) | WB-STRAIN:WBStrain00035522 | WormBase (WB) | WB | available | PMID:32847964 PMID:37728328 PMID:37773959 |
WB-STRAIN:VC125, CGC_VC125 | 2026-07-25 10:23:59 | 0 | ||
|
VC119 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035521 | Caenorhabditis elegans | ptb-1(gk113) II. | D2089.4. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00004207(ptb-1) | WBGene00004207(ptb-1) | WB-STRAIN:WBStrain00035521 | WormBase (WB) | WB | available | WB-STRAIN:VC119, CGC_VC119 | 2026-07-25 10:24:00 | 0 | |||
|
VC141 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00035537 | Caenorhabditis elegans | zif-1(gk117) III. | F59B2.6. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006977(zif-1) | WBGene00006977(zif-1) | WB-STRAIN:WBStrain00035537 | WormBase (WB) | WB | available | WB-STRAIN:VC141, CGC_VC141 | 2026-07-25 10:23:59 | 2 | |||
|
VC140 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035536 | Caenorhabditis elegans | eif-3.K(gk126) V. | Mutagen:UV/TMP|"T16G1.11. Superficially wild type."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001233(eif-3.K) | WBGene00001233(eif-3.K) | WB-STRAIN:WBStrain00035536 | WormBase (WB) | WB | available | WB-STRAIN:VC140, CGC_VC140 | 2026-07-25 10:24:00 | 0 | |||
|
VC142 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035538 | Caenorhabditis elegans | dgk-2(gk124) X. | F46H6.2. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000959(dgk-2) | WBGene00000959(dgk-2) | WB-STRAIN:WBStrain00035538 | WormBase (WB) | WB | available | WB-STRAIN:VC142, CGC_VC142 | 2026-07-25 10:23:59 | 0 | |||
|
VC135 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035531 | Caenorhabditis elegans | tag-4(gk128) I. | Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK337.4. Superficially wild type." | WBGene00006399(tag-4) | WBGene00006399(tag-4) | WB-STRAIN:WBStrain00035531 | WormBase (WB) | WB | available | WB-STRAIN:VC135, CGC_VC135 | 2026-07-25 10:23:59 | 0 | |||
|
VC138 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00035534 | Caenorhabditis elegans | elo-1(gk48) IV. | F56H1.4. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001239(elo-1) | WBGene00001239(elo-1) | WB-STRAIN:WBStrain00035534 | WormBase (WB) | WB | available | WB-STRAIN:VC138, CGC_VC138 | 2026-07-25 10:23:59 | 1 | |||
|
VC100 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035508 | Caenorhabditis elegans | unc-112(r367) V; gkDf2 X. | gkDf2. Multiple genes deleted. Deletion extents determined by oligo array CGH. Deletion size: ~44kb. Deletion left flank: TTAGTAAGCCGGAAAATGGATTTCGCTTTTCTCCTATTGAGAAACCTAAA. Deletion right flank: CTACCTTTCAAAATGAATAGCAACCACTTTTTCGACGAAGAAATGTTCGT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006836(unc-112) | WBGene00006836(unc-112) | WB-STRAIN:WBStrain00035508 | WormBase (WB) | WB | available | WB-STRAIN:VC100, CGC_VC100 | 2026-07-25 10:23:59 | 0 | |||
|
VC107 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00035509 | Caenorhabditis elegans | tts-1(gk105) X. | F09E10.10. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006650(tts-1) | WBGene00006650(tts-1) | WB-STRAIN:WBStrain00035509 | WormBase (WB) | WB | available | WB-STRAIN:VC107, CGC_VC107 | 2026-07-25 10:24:00 | 0 | |||
|
VC208 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00035584 | Caenorhabditis elegans | cdd-1(ok390) X. | C47D2.2. Superficially wild type.|"Mutagen:UV/TMP"|"Reference WBPaper00059294 added based on published strain data identified by Textpresso literature search."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000391(cdd-1) | WBGene00000391(cdd-1) | WB-STRAIN:WBStrain00035584 | WormBase (WB) | WB | available | PMID:32049015 | WB-STRAIN:VC208, CGC_VC208 | 2026-07-25 10:24:01 | 1 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
