Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search
Reset search
On page 81 showing 1601 ~ 1620 out of 64,152 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:WB-STRAIN:WBStrain00040886

http://www.wormbase.org/db/get?name=WBStrain00040886

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
References:
Synonyms: lin-15B&lin-15A(n765) X; zwEx104.
Alternate IDs: WB-STRAIN:ZW284, CGC_ZW284
Notes: zwEx104 [inx-4p::GFP + lin-15(+)]. Pick non-Muv to maintain. Maintain under normal conditions. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).

Proper citation: RRID:WB-STRAIN:WBStrain00040886 Copy   

    • RRID:WB-STRAIN:WBStrain00040883

http://www.wormbase.org/db/get?name=WBStrain00040883

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
References:
Synonyms: lin-15B&lin-15A(n765) X; zwEx101.
Alternate IDs: WB-STRAIN:ZW281, CGC_ZW281
Notes: zwEx101 [inx-1p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).

Proper citation: RRID:WB-STRAIN:WBStrain00040883 Copy   

    • RRID:WB-STRAIN:WBStrain00040884

http://www.wormbase.org/db/get?name=WBStrain00040884

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
References:
Synonyms: lin-15B&lin-15A(n765) X; zwEx102.
Alternate IDs: WB-STRAIN:ZW282, CGC_ZW282
Notes: zwEx102 [inx-2p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).

Proper citation: RRID:WB-STRAIN:WBStrain00040884 Copy   

    • RRID:WB-STRAIN:WBStrain00040858

http://www.wormbase.org/db/get?name=WBStrain00040858

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000898(daf-2)
Genomic Alteration: WBGene00000898(daf-2)
Availability: available
References:
Synonyms: daf-2(e1370) III; oxIs22.
Alternate IDs: WB-STRAIN:ZM4864, CGC_ZM4864
Notes: oxIs22 [unc-49p::unc-49::GFP + lin-15(+)]. Temperature-sensitive Daf-c. GFP punctae are relatively normal in dauers. Maintain at 15C. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.

Proper citation: RRID:WB-STRAIN:WBStrain00040858 Copy   

    • RRID:WB-STRAIN:WBStrain00040857

http://www.wormbase.org/db/get?name=WBStrain00040857

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: available
References:
Synonyms: hpIs166.
Alternate IDs: WB-STRAIN:ZM4624, CGC_ZM4624
Notes: hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. Reference: Gao S, et al. 2015. Nature Communications 6, Article number: 6323.

Proper citation: RRID:WB-STRAIN:WBStrain00040857 Copy   

    • RRID:WB-STRAIN:WBStrain00040855

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00040855

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003558(nca-2)|WBGene00006809(unc-77)
Genomic Alteration: WBGene00003558(nca-2), WBGene00006809(unc-77)
Availability: available
References:
Synonyms: nca-2(gk5) III; unc-77(gk9) IV.
Alternate IDs: WB-STRAIN:ZM2960, CGC_ZM2960
Notes: Uncoordinated behaviour. Fainter, pauses quickly after stimulating touch-response by prodding or tapping plate. References: Humphry JA, et al. Curr Biol. 2007 Apr 3;17(7):624-9. Gao S, et al. Nat Commun. 2015 Feb 26;6:6323.

Proper citation: RRID:WB-STRAIN:WBStrain00040855 Copy   

    • RRID:WB-STRAIN:WBStrain00040850

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00040850

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006364(syd-2)
Genomic Alteration: WBGene00006364(syd-2)
Availability: available
References:
Synonyms: syd-2(ok217) X.
Alternate IDs: WB-STRAIN:ZM607, CGC_ZM607
Notes: Egl. Backward stiff and slow moving. Sluggish. Can move fast when poked. Outer pairs: F59F5.6EL1 (TTGCATCTGCAAAAGAAACG); F59F5.6ER1 (GCTCCGAACGAAAGAAGTTG). Inner pairs: F59F5.6IL1 (AATCTCTAACCATGCGGTCG); F59F5.6IR1 (CGCGGGAATTATGCCTATTA).|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"WBStrain mapped, WBPaper00060580 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00040850 Copy   

    • RRID:WB-STRAIN:WBStrain00040851

http://www.wormbase.org/db/get?name=WBStrain00040851

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000898(daf-2)
Genomic Alteration: WBGene00000898(daf-2)
Availability: available
References:
Synonyms: daf-2(e1370) III; juIs1 IV.
Alternate IDs: WB-STRAIN:ZM1157, CGC_ZM1157
Notes: juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. Temperature-sensitive Daf-c. GFP punctae are relatively normal in dauers. Maintain at 15C. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.

Proper citation: RRID:WB-STRAIN:WBStrain00040851 Copy   

    • RRID:WB-STRAIN:WBStrain00040869

http://www.wormbase.org/db/get?name=WBStrain00040869

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000898(daf-2)
Genomic Alteration: WBGene00000898(daf-2)
Availability: available
References:
Synonyms: daf-2(m596) III; hpEx3369.
Alternate IDs: WB-STRAIN:ZM8562, CGC_ZM8562
Notes: hpEx3369 [myo-2p::RFP + ges-1p(short)::daf-2]. Transgenic worms do not dauer. Pick RFP+ animals to maintain. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.

Proper citation: RRID:WB-STRAIN:WBStrain00040869 Copy   

    • RRID:WB-STRAIN:WBStrain00040868

http://www.wormbase.org/db/get?name=WBStrain00040868

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000898(daf-2)
Genomic Alteration: WBGene00000898(daf-2)
Availability: available
References:
Synonyms: daf-2(m596) III; hpEx2906.
Alternate IDs: WB-STRAIN:ZM8561, CGC_ZM8561
Notes: hpEx2906 [myo-2p::RFP + rgef-1p::daf-2]. Transgenic worms dauer easily. Pick RFP+ animals to maintain. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.

Proper citation: RRID:WB-STRAIN:WBStrain00040868 Copy   

    • RRID:WB-STRAIN:WBStrain00040901

http://www.wormbase.org/db/get?name=WBStrain00040901

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
References:
Synonyms: lin-15B&lin-15A(n765) X; zwEx119.
Alternate IDs: WB-STRAIN:ZW299, CGC_ZW299
Notes: zwEx119 [inx-19p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).

Proper citation: RRID:WB-STRAIN:WBStrain00040901 Copy   

    • RRID:WB-STRAIN:WBStrain00040865

http://www.wormbase.org/db/get?name=WBStrain00040865

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003558(nca-2)|WBGene00006809(unc-77)
Genomic Alteration: WBGene00003558(nca-2), WBGene00006809(unc-77)
Availability: available
References:
Synonyms: unc-77(gk9); nca-2(gk5); hpIs166; hpEx3239.
Alternate IDs: WB-STRAIN:ZM7765, CGC_ZM7765
Notes: hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3239 [lgc-55p::nca-1::GFP + nmr-1p::ATG::nca-1 + nca-1::GFP + myo-2p::RFP]. Pick RFP+ to maintain. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.

Proper citation: RRID:WB-STRAIN:WBStrain00040865 Copy   

    • RRID:WB-STRAIN:WBStrain00040866

http://www.wormbase.org/db/get?name=WBStrain00040866

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000920(daf-28)
Genomic Alteration: WBGene00000920(daf-28)
Availability: available
References:
Synonyms: hpDf761 II; daf-28(tm2308) V.
Alternate IDs: WB-STRAIN:ZM7963, CGC_ZM7963
Notes: Temperature-sensitive Daf-c. Maintain at 15C. hpDf761 removes ins-4, ins-5, and ins-6. Reference: Hung WL, et al. Development. 2014 Apr;141(8):1767-79.

Proper citation: RRID:WB-STRAIN:WBStrain00040866 Copy   

    • RRID:WB-STRAIN:WBStrain00040860

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00040860

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: available
References:
Synonyms: hpIs202.
Alternate IDs: WB-STRAIN:ZM5488, CGC_ZM5488
Notes: hpIs202 [ceh-10p::GFP + lin-15(+)]. GFP is expressed by four neurons RID, AIY, CAN, ALA, and one sheath cell. References: Wang et al., 2015. Development 142(8):1447-57. doi: 10.1242/dev.119479. Lim et al., 2016. Elife 5. pii: e19887. doi: 10.7554/eLife.19887.

Proper citation: RRID:WB-STRAIN:WBStrain00040860 Copy   

    • RRID:WB-STRAIN:WBStrain00040862

http://www.wormbase.org/db/get?name=WBStrain00040862

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003558(nca-2)|WBGene00006809(unc-77)
Genomic Alteration: WBGene00003558(nca-2), WBGene00006809(unc-77)
Availability: available
References:
Synonyms: unc-77(gk9); nca-2(gk5); hpIs166; hpEx3088.
Alternate IDs: WB-STRAIN:ZM7212, CGC_ZM7212
Notes: hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3088 [rgef-1p::ATG::nca-1 + nca-1::GFP + myo-2p::RFP]. Pick RFP+ to maintain. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.

Proper citation: RRID:WB-STRAIN:WBStrain00040862 Copy   

    • RRID:WB-STRAIN:WBStrain00040839

http://www.wormbase.org/db/get?name=WBStrain00040839

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001554(gcy-34)
Genomic Alteration: WBGene00001554(gcy-34)
Availability: unknown
References:
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:ZG605
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00040839 Copy   

    • RRID:WB-STRAIN:WBStrain00040835

http://www.wormbase.org/db/get?name=WBStrain00040835

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed3) III; iaIs28.
Alternate IDs: WB-STRAIN:ZG580, CGC_ZG580
Notes: iaIs28 contains [hif-1p::hif-1a::tag + unc-119(+)]. Published in Zhang et al PLoS ONE 4: e6348 (2009).

Proper citation: RRID:WB-STRAIN:WBStrain00040835 Copy   

    • RRID:WB-STRAIN:WBStrain00040837

http://www.wormbase.org/db/get?name=WBStrain00040837

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001851(hif-1)
Genomic Alteration: WBGene00001851(hif-1)
Availability: available
References:
Synonyms: hif-1(ia7) V.
Alternate IDs: WB-STRAIN:ZG596, CGC_ZG596
Notes: Made_by: Yi Zhang & C Shen|"Published in Zhang et al PLoS ONE 4: e6348 (2009)."

Proper citation: RRID:WB-STRAIN:WBStrain00040837 Copy   

    • RRID:WB-STRAIN:WBStrain00040832

http://www.wormbase.org/db/get?name=WBStrain00040832

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001178(egl-9)
Genomic Alteration: WBGene00001178(egl-9)
Availability: available
References:
Synonyms: iaIs7 IV; egl-9(ia61) V.
Alternate IDs: WB-STRAIN:ZG449, CGC_ZG449
Notes: iaIs7 contains [nhr-57p::GFP + unc-119(+)]. ia61 was induced by Mos1 mutagenesis. Egl. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).

Proper citation: RRID:WB-STRAIN:WBStrain00040832 Copy   

    • RRID:WB-STRAIN:WBStrain00040834

http://www.wormbase.org/db/get?name=WBStrain00040834

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001178(egl-9)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00001178(egl-9), WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed3) III; egl-9(sa307) V; iaIs38.
Alternate IDs: WB-STRAIN:ZG494, CGC_ZG494
Notes: iaIs38 contains [egl-9p::egl-9::tag + unc-119(+)]. Superficially WT. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).

Proper citation: RRID:WB-STRAIN:WBStrain00040834 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. PRECISE-TBI Resources

    Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within PRECISE-TBI that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

The PRECISE-TBI toolbox are a collection tools and resources to increase rigor and reproducibility with Traumatic Brain Injury within the PRE Clinical Interagency reSearch resourcE - Traumatic Brain Injury (PRECISE-TBI). Please learn more about PRECISE-TBI at https://www.precise-tbi.org

Recent News Entries

Contact Us

Department of Neurosciences, School of Medicine

University of California, San Diego





About SciCrunch | Privacy Policy | Terms of Service

SciCrunch