Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search
Reset search
On page 80 showing 1581 ~ 1600 out of 64,152 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:WB-STRAIN:WBStrain00040703

http://www.wormbase.org/db/get?name=WBStrain00040703

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001851(hif-1)
Genomic Alteration: WBGene00001851(hif-1)
Availability: available
References:
Synonyms: hif-1(ia4) V; yakEx125.
Alternate IDs: WB-STRAIN:XZ2084, CGC_XZ2084
Notes: yakEx125 [rab-3p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from pan-neuronal-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx125 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https:

Proper citation: RRID:WB-STRAIN:WBStrain00040703 Copy   

    • RRID:WB-STRAIN:WBStrain00040706

http://www.wormbase.org/db/get?name=WBStrain00040706

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00045237(mrt-1)
Genomic Alteration: WBGene00045237(mrt-1)
Availability: available
References:
Synonyms: mrt-1(yp2) I.
Alternate IDs: WB-STRAIN:YA1039, CGC_YA1039
Notes: yp2 mutation perturbs the MRT-1 DNA-binding domain. Mortal germline. Progressive telomere shortening due to telomerase dysfunction. Hypersensitive to DNA interstrand crosslinking agents. This strain will becomce sterile after propagating 10-20 generations. mrt-1 mutants can be rejuvenated by outcrossing. Reference: Meier B, et al. EMBO J. 2009 Nov 18;28(22):3549-63.|"yp2 mutation perturbs the MRT-1 DNA-binding domain. Mortal germline. Progressive telomere shortening due to telomerase dysfunction. Hypersensitive to DNA interstrand crosslinking agents. This strain will become sterile after propagating 10-20 generations. mrt-1 mutants can be rejuvenated by outcrossing. Reference: Meier B, et al. EMBO J. 2009 Nov 18;28(22):3549-63."

Proper citation: RRID:WB-STRAIN:WBStrain00040706 Copy   

    • RRID:WB-STRAIN:WBStrain00040780

http://www.wormbase.org/db/get?name=WBStrain00040780

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000426(ced-12)
Genomic Alteration: WBGene00000426(ced-12)
Availability: available
References:
Synonyms: ced-12(bz187) I.
Alternate IDs: WB-STRAIN:ZB547, CGC_ZB547
Notes: Induces persistence of programmed cell death corpses and necrotic cell death corpses.

Proper citation: RRID:WB-STRAIN:WBStrain00040780 Copy   

    • RRID:WB-STRAIN:WBStrain00040781

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00040781

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000802(crt-1)
Genomic Alteration: WBGene00000802(crt-1)
Availability: available
References:
Synonyms: crt-1(bz29) V.
Alternate IDs: WB-STRAIN:ZB1028, CGC_ZB1028
Notes: Probably null calreticulin. W28 amber. Slow growth (one day developmental delay). Nearly sterile if raised at 25C. Suppresses mec-4(d)-induced neurodegeneration. Bent-head.

Proper citation: RRID:WB-STRAIN:WBStrain00040781 Copy   

    • RRID:WB-STRAIN:WBStrain00040788

http://www.wormbase.org/db/get?name=WBStrain00040788

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001623(glt-5)
Genomic Alteration: WBGene00001623(glt-5)
Availability: available
References:
Synonyms: glt-5(bz70) II.
Alternate IDs: WB-STRAIN:ZB1099, CGC_ZB1099
Notes: Reference: Mano et al. (2007) J Biol Chem 282(47):34412-9.

Proper citation: RRID:WB-STRAIN:WBStrain00040788 Copy   

    • RRID:WB-STRAIN:WBStrain00040787

http://www.wormbase.org/db/get?name=WBStrain00040787

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001622(glt-4)
Genomic Alteration: WBGene00001622(glt-4)
Availability: available
References:
Synonyms: glt-4(bz69) II.
Alternate IDs: WB-STRAIN:ZB1098, CGC_ZB1098
Notes: Reference: Mano et al. (2007) J Biol Chem 282(47):34412-9.

Proper citation: RRID:WB-STRAIN:WBStrain00040787 Copy   

    • RRID:WB-STRAIN:WBStrain00040702

http://www.wormbase.org/db/get?name=WBStrain00040702

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001851(hif-1)
Genomic Alteration: WBGene00001851(hif-1)
Availability: available
References:
Synonyms: hif-1(ia4) V; yakEx145.
Alternate IDs: WB-STRAIN:XZ2083, CGC_XZ2083
Notes: yakEx145 [unc-47p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from GABA-ergic neuron-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx145 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https:

Proper citation: RRID:WB-STRAIN:WBStrain00040702 Copy   

    • RRID:WB-STRAIN:WBStrain00040784

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00040784

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000802(crt-1)
Genomic Alteration: WBGene00000802(crt-1)
Availability: available
References:
Synonyms: crt-1(bz50) V.
Alternate IDs: WB-STRAIN:ZB1031, CGC_ZB1031
Notes: Point mutation in G102E. No easily detected phenotype, selected for suppression of mec-4(d)-induced degeneration caused by ectopic expression of mec-4(u231) in the ventral nerve cord. Bent-head.

Proper citation: RRID:WB-STRAIN:WBStrain00040784 Copy   

    • RRID:WB-STRAIN:WBStrain00040783

http://www.wormbase.org/db/get?name=WBStrain00040783

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000802(crt-1)
Genomic Alteration: WBGene00000802(crt-1)
Availability: available
References:
Synonyms: crt-1(bz31) V.
Alternate IDs: WB-STRAIN:ZB1030, CGC_ZB1030
Notes: Point mutation C133Y. No easily detected phenotype, selected for suppression of mec-4(d)-induced degeneration caused by ectopic expression of mec-4(d)-induced neurodegeneration. Bent-head.

Proper citation: RRID:WB-STRAIN:WBStrain00040783 Copy   

    • RRID:WB-STRAIN:WBStrain00040786

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00040786

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001621(glt-3)
Genomic Alteration: WBGene00001621(glt-3)
Availability: unknown
References:
Synonyms: glt-3(bz34) IV.
Alternate IDs: WB-STRAIN:ZB1096
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00040786 Copy   

    • RRID:WB-STRAIN:WBStrain00040879

http://www.wormbase.org/db/get?name=WBStrain00040879

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00017641(csr-1)
Genomic Alteration: WBGene00017641(csr-1)
Availability: available
References:
Synonyms: csr-1(fj54) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:ZT3, CGC_ZT3
Notes: Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. The fj54 mutation deletes a 524 bp region including half of the second exon, the third exon, and almost all of the fourth exon, causing a frame shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA.|"Made_by: Moriguchi/Tabara"|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00040879 Copy   

    • RRID:WB-STRAIN:WBStrain00040875

http://www.wormbase.org/db/get?name=WBStrain00040875

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00004319(rbr-2)
Genomic Alteration: WBGene00004319(rbr-2)
Availability: available
References:
Synonyms: rbr-2(tm1231) IV.
Alternate IDs: WB-STRAIN:ZR1, CGC_ZR1
Notes: 648 bp deletion (confirmed). About 80% of animals show defects in vulval development (Muv or Vul).

Proper citation: RRID:WB-STRAIN:WBStrain00040875 Copy   

    • RRID:WB-STRAIN:WBStrain00040878

http://www.wormbase.org/db/get?name=WBStrain00040878

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000254(bli-4)|WBGene00008400(drh-3)
Genomic Alteration: WBGene00000254(bli-4), WBGene00008400(drh-3)
Availability: available
References:
Synonyms: drh-3(fj52) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:ZT2, CGC_ZT2
Notes: Heterozygotes are WT. drh-3 homozygotes are sterile. the fj52 mutation deletes a 405 bp region including the promoter, the first exon and half of the second exon. The deletion can be checked by PCR with the following primers: TTTATTGATTCCGCCGTTGCTC and TGCAGCTCCAGCCACTCTATCA. The fj52 mutation was isolated from a deletion mutant libray of the K. Nishiwaki group. Homozygous hT2[bli-4 let-? qIs48] inviable.|"Made_by: Moriguchi/Kuroki"|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00040878 Copy   

    • RRID:WB-STRAIN:WBStrain00040877

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00040877

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003473(mtl-1)|WBGene00003474(mtl-2)
Genomic Alteration: WBGene00003473(mtl-1), WBGene00003474(mtl-2)
Availability: unknown
References:
Synonyms: mtl-1(tm1770) mtl-2(gk125) V.
Alternate IDs: WB-STRAIN:ZS1
Notes: This strain is described as zs1. It should be ZS1

Proper citation: RRID:WB-STRAIN:WBStrain00040877 Copy   

    • RRID:WB-STRAIN:WBStrain00040871

http://www.wormbase.org/db/get?name=WBStrain00040871

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000898(daf-2)
Genomic Alteration: WBGene00000898(daf-2)
Availability: available
References:
Synonyms: daf-2(m596) III; hpEx2905.
Alternate IDs: WB-STRAIN:ZM9028, CGC_ZM9028
Notes: hpEx2905 [myo-2p::RFP + myo-3p::daf-2]. Pick RFP+ to maintain. Maintain at 15C. Temperature sensitive dauer constitutive. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.

Proper citation: RRID:WB-STRAIN:WBStrain00040871 Copy   

    • RRID:WB-STRAIN:WBStrain00040806

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00040806

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006575(tir-1)
Genomic Alteration: WBGene00006575(tir-1)
Availability: available
References:
Synonyms: tir-1(qd4) III.
Alternate IDs: WB-STRAIN:ZD101, CGC_ZD101
Notes: Enhanced pathogen susceptibility. Egg laying in response to food is defective. Reference: Shivers RP et al., (2009) Cell Host Microbe 6:321-30.

Proper citation: RRID:WB-STRAIN:WBStrain00040806 Copy   

    • RRID:WB-STRAIN:WBStrain00040809

http://www.wormbase.org/db/get?name=WBStrain00040809

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00004758(sek-1)
Genomic Alteration: WBGene00004758(sek-1)
Availability: available
References:
Synonyms: sek-1(km4) X; qdEx11.
Alternate IDs: WB-STRAIN:ZD260, CGC_ZD260
Notes: no longer available from the CGC.|"qdEx11 [osm-5p::sek-1(cDNA)::GFP::unc-54-3' UTR + myo-2p::mStrawberry::unc-54-3' UTR]. Array rescues sek-1 in ciliated sensory neurons. References: Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30."

Proper citation: RRID:WB-STRAIN:WBStrain00040809 Copy   

    • RRID:WB-STRAIN:WBStrain00040808

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00040808

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00004758(sek-1)
Genomic Alteration: WBGene00004758(sek-1)
Availability: available
References:
Synonyms: sek-1(km4) X; qdEx8.
Alternate IDs: WB-STRAIN:ZD202, CGC_ZD202
Notes: qdEx8 [unc-119p::sek-1(cDNA)::GFP::unc-54-3' UTR + myo-2p::mStrawberry::unc-54-3' UTR]. Array rescues sek-1 in neurons. References: Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30.

Proper citation: RRID:WB-STRAIN:WBStrain00040808 Copy   

    • RRID:WB-STRAIN:WBStrain00040802

http://www.wormbase.org/db/get?name=WBStrain00040802

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00021316(Y32H12A.8)
Genomic Alteration: WBGene00021316(Y32H12A.8)
Availability: available
References:
Synonyms: Y32H12A.8(tm419) III.
Alternate IDs: WB-STRAIN:ZB2774, CGC_ZB2774
Notes: Made_by:

Proper citation: RRID:WB-STRAIN:WBStrain00040802 Copy   

    • RRID:WB-STRAIN:WBStrain00040881

http://www.wormbase.org/db/get?name=WBStrain00040881

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: available
References:
Synonyms: zwIs106.
Alternate IDs: WB-STRAIN:ZW127, CGC_ZW127
Notes: zwIs106 contains [unc-9p::GFP + lin-15(+)]. Superficially wild-type. Maintain under normal conditions. Described in Altun et al. Dev Dyn 238:1936-50 (2009).

Proper citation: RRID:WB-STRAIN:WBStrain00040881 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. PRECISE-TBI Resources

    Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within PRECISE-TBI that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

The PRECISE-TBI toolbox are a collection tools and resources to increase rigor and reproducibility with Traumatic Brain Injury within the PRE Clinical Interagency reSearch resourcE - Traumatic Brain Injury (PRECISE-TBI). Please learn more about PRECISE-TBI at https://www.precise-tbi.org

Recent News Entries

Contact Us

Department of Neurosciences, School of Medicine

University of California, San Diego





About SciCrunch | Privacy Policy | Terms of Service

SciCrunch