Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
XZ2084 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040703 | Caenorhabditis elegans | hif-1(ia4) V; yakEx125. | yakEx125 [rab-3p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from pan-neuronal-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx125 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https: | WBGene00001851(hif-1) | WBGene00001851(hif-1) | WB-STRAIN:WBStrain00040703 | WormBase (WB) | WB | available | WB-STRAIN:XZ2084, CGC_XZ2084 | 2026-07-25 10:25:07 | 0 | |||
|
YA1039 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040706 | Caenorhabditis elegans | mrt-1(yp2) I. | yp2 mutation perturbs the MRT-1 DNA-binding domain. Mortal germline. Progressive telomere shortening due to telomerase dysfunction. Hypersensitive to DNA interstrand crosslinking agents. This strain will becomce sterile after propagating 10-20 generations. mrt-1 mutants can be rejuvenated by outcrossing. Reference: Meier B, et al. EMBO J. 2009 Nov 18;28(22):3549-63.|"yp2 mutation perturbs the MRT-1 DNA-binding domain. Mortal germline. Progressive telomere shortening due to telomerase dysfunction. Hypersensitive to DNA interstrand crosslinking agents. This strain will become sterile after propagating 10-20 generations. mrt-1 mutants can be rejuvenated by outcrossing. Reference: Meier B, et al. EMBO J. 2009 Nov 18;28(22):3549-63." | WBGene00045237(mrt-1) | WBGene00045237(mrt-1) | WB-STRAIN:WBStrain00040706 | WormBase (WB) | WB | available | WB-STRAIN:YA1039, CGC_YA1039 | 2026-07-25 10:25:07 | 0 | |||
|
ZB547 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040780 | Caenorhabditis elegans | ced-12(bz187) I. | Induces persistence of programmed cell death corpses and necrotic cell death corpses. | WBGene00000426(ced-12) | WBGene00000426(ced-12) | WB-STRAIN:WBStrain00040780 | WormBase (WB) | WB | available | WB-STRAIN:ZB547, CGC_ZB547 | 2026-07-25 10:25:08 | 0 | |||
|
ZB1028 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00040781 | Caenorhabditis elegans | crt-1(bz29) V. | Probably null calreticulin. W28 amber. Slow growth (one day developmental delay). Nearly sterile if raised at 25C. Suppresses mec-4(d)-induced neurodegeneration. Bent-head. | WBGene00000802(crt-1) | WBGene00000802(crt-1) | WB-STRAIN:WBStrain00040781 | WormBase (WB) | WB | available | WB-STRAIN:ZB1028, CGC_ZB1028 | 2026-07-25 10:25:08 | 1 | |||
|
ZB1099 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040788 | Caenorhabditis elegans | glt-5(bz70) II. | Reference: Mano et al. (2007) J Biol Chem 282(47):34412-9. | WBGene00001623(glt-5) | WBGene00001623(glt-5) | WB-STRAIN:WBStrain00040788 | WormBase (WB) | WB | available | PMID:17681948 | WB-STRAIN:ZB1099, CGC_ZB1099 | 2026-07-25 10:25:08 | 0 | ||
|
ZB1098 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040787 | Caenorhabditis elegans | glt-4(bz69) II. | Reference: Mano et al. (2007) J Biol Chem 282(47):34412-9. | WBGene00001622(glt-4) | WBGene00001622(glt-4) | WB-STRAIN:WBStrain00040787 | WormBase (WB) | WB | available | PMID:17681948 | WB-STRAIN:ZB1098, CGC_ZB1098 | 2026-07-25 10:25:08 | 0 | ||
|
XZ2083 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040702 | Caenorhabditis elegans | hif-1(ia4) V; yakEx145. | yakEx145 [unc-47p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from GABA-ergic neuron-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx145 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https: | WBGene00001851(hif-1) | WBGene00001851(hif-1) | WB-STRAIN:WBStrain00040702 | WormBase (WB) | WB | available | WB-STRAIN:XZ2083, CGC_XZ2083 | 2026-07-25 10:25:07 | 0 | |||
|
ZB1031 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00040784 | Caenorhabditis elegans | crt-1(bz50) V. | Point mutation in G102E. No easily detected phenotype, selected for suppression of mec-4(d)-induced degeneration caused by ectopic expression of mec-4(u231) in the ventral nerve cord. Bent-head. | WBGene00000802(crt-1) | WBGene00000802(crt-1) | WB-STRAIN:WBStrain00040784 | WormBase (WB) | WB | available | WB-STRAIN:ZB1031, CGC_ZB1031 | 2026-07-25 10:25:08 | 1 | |||
|
ZB1030 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040783 | Caenorhabditis elegans | crt-1(bz31) V. | Point mutation C133Y. No easily detected phenotype, selected for suppression of mec-4(d)-induced degeneration caused by ectopic expression of mec-4(d)-induced neurodegeneration. Bent-head. | WBGene00000802(crt-1) | WBGene00000802(crt-1) | WB-STRAIN:WBStrain00040783 | WormBase (WB) | WB | available | WB-STRAIN:ZB1030, CGC_ZB1030 | 2026-07-25 10:25:08 | 0 | |||
|
ZB1096 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00040786 | Caenorhabditis elegans | glt-3(bz34) IV. | EMPTY | WBGene00001621(glt-3) | WBGene00001621(glt-3) | WB-STRAIN:WBStrain00040786 | WormBase (WB) | WB | unknown | PMID:17681948 | WB-STRAIN:ZB1096 | 2026-07-25 10:25:08 | 1 | ||
|
ZT3 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040879 | Caenorhabditis elegans | csr-1(fj54) IV/nT1 [qIs51] (IV;V). | Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. The fj54 mutation deletes a 524 bp region including half of the second exon, the third exon, and almost all of the fourth exon, causing a frame shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA.|"Made_by: Moriguchi/Tabara"|"Mutagen:UV/TMP" | WBGene00017641(csr-1) | WBGene00017641(csr-1) | WB-STRAIN:WBStrain00040879 | WormBase (WB) | WB | available | PMID:37078421 | WB-STRAIN:ZT3, CGC_ZT3 | 2026-07-25 10:25:09 | 0 | ||
|
ZR1 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040875 | Caenorhabditis elegans | rbr-2(tm1231) IV. | 648 bp deletion (confirmed). About 80% of animals show defects in vulval development (Muv or Vul). | WBGene00004319(rbr-2) | WBGene00004319(rbr-2) | WB-STRAIN:WBStrain00040875 | WormBase (WB) | WB | available | WB-STRAIN:ZR1, CGC_ZR1 | 2026-07-25 10:25:09 | 0 | |||
|
ZT2 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040878 | Caenorhabditis elegans | drh-3(fj52) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | Heterozygotes are WT. drh-3 homozygotes are sterile. the fj52 mutation deletes a 405 bp region including the promoter, the first exon and half of the second exon. The deletion can be checked by PCR with the following primers: TTTATTGATTCCGCCGTTGCTC and TGCAGCTCCAGCCACTCTATCA. The fj52 mutation was isolated from a deletion mutant libray of the K. Nishiwaki group. Homozygous hT2[bli-4 let-? qIs48] inviable.|"Made_by: Moriguchi/Kuroki"|"Mutagen:UV/TMP" | WBGene00000254(bli-4)|WBGene00008400(drh-3) | WBGene00000254(bli-4), WBGene00008400(drh-3) | WB-STRAIN:WBStrain00040878 | WormBase (WB) | WB | available | WB-STRAIN:ZT2, CGC_ZT2 | 2026-07-25 10:25:09 | 0 | |||
|
ZS1 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00040877 | Caenorhabditis elegans | mtl-1(tm1770) mtl-2(gk125) V. | This strain is described as zs1. It should be ZS1 | WBGene00003473(mtl-1)|WBGene00003474(mtl-2) | WBGene00003473(mtl-1), WBGene00003474(mtl-2) | WB-STRAIN:WBStrain00040877 | WormBase (WB) | WB | unknown | PMID:17141712 PMID:38374083 |
WB-STRAIN:ZS1 | 2026-07-25 10:25:09 | 1 | ||
|
ZM9028 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040871 | Caenorhabditis elegans | daf-2(m596) III; hpEx2905. | hpEx2905 [myo-2p::RFP + myo-3p::daf-2]. Pick RFP+ to maintain. Maintain at 15C. Temperature sensitive dauer constitutive. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79. | WBGene00000898(daf-2) | WBGene00000898(daf-2) | WB-STRAIN:WBStrain00040871 | WormBase (WB) | WB | available | WB-STRAIN:ZM9028, CGC_ZM9028 | 2026-07-25 10:25:09 | 0 | |||
|
ZD101 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00040806 | Caenorhabditis elegans | tir-1(qd4) III. | Enhanced pathogen susceptibility. Egg laying in response to food is defective. Reference: Shivers RP et al., (2009) Cell Host Microbe 6:321-30. | WBGene00006575(tir-1) | WBGene00006575(tir-1) | WB-STRAIN:WBStrain00040806 | WormBase (WB) | WB | available | PMID:37122724 PMID:38232128 |
WB-STRAIN:ZD101, CGC_ZD101 | 2026-07-25 10:25:08 | 4 | ||
|
ZD260 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040809 | Caenorhabditis elegans | sek-1(km4) X; qdEx11. | no longer available from the CGC.|"qdEx11 [osm-5p::sek-1(cDNA)::GFP::unc-54-3' UTR + myo-2p::mStrawberry::unc-54-3' UTR]. Array rescues sek-1 in ciliated sensory neurons. References: Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30." | WBGene00004758(sek-1) | WBGene00004758(sek-1) | WB-STRAIN:WBStrain00040809 | WormBase (WB) | WB | available | WB-STRAIN:ZD260, CGC_ZD260 | 2026-07-25 10:25:08 | 0 | |||
|
ZD202 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00040808 | Caenorhabditis elegans | sek-1(km4) X; qdEx8. | qdEx8 [unc-119p::sek-1(cDNA)::GFP::unc-54-3' UTR + myo-2p::mStrawberry::unc-54-3' UTR]. Array rescues sek-1 in neurons. References: Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30. | WBGene00004758(sek-1) | WBGene00004758(sek-1) | WB-STRAIN:WBStrain00040808 | WormBase (WB) | WB | available | WB-STRAIN:ZD202, CGC_ZD202 | 2026-07-25 10:25:08 | 1 | |||
|
ZB2774 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040802 | Caenorhabditis elegans | Y32H12A.8(tm419) III. | Made_by: | WBGene00021316(Y32H12A.8) | WBGene00021316(Y32H12A.8) | WB-STRAIN:WBStrain00040802 | WormBase (WB) | WB | available | WB-STRAIN:ZB2774, CGC_ZB2774 | 2026-07-25 10:25:08 | 0 | |||
|
ZW127 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00040881 | Caenorhabditis elegans | zwIs106. | zwIs106 contains [unc-9p::GFP + lin-15(+)]. Superficially wild-type. Maintain under normal conditions. Described in Altun et al. Dev Dyn 238:1936-50 (2009). | WB-STRAIN:WBStrain00040881 | WormBase (WB) | WB | available | WB-STRAIN:ZW127, CGC_ZW127 | 2026-07-25 10:25:09 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
