Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131952
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 5131952
Notes: This strain was produced by injecting ZFNs targeting the sequence CCTGGGGACTTCACACCCACccattcCCATAGTGCACTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 4.
Proper citation: RRID:RGD_5131952 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131953
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Extinct (as of 2017-01-26)
References:
Synonyms:
Alternate IDs: 5131953
Notes: This strain was produced by injecting ZFNs targeting the sequence CGCCATGACCCTGTGCtatgcCAGGGTGTCCCGAGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 2.
Proper citation: RRID:RGD_5131953 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131954
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Extinct (as of 2017-01-26)
References:
Synonyms:
Alternate IDs: 5131954
Notes: This strain was produced by injecting ZFNs targeting the sequence CTTATTCCTTTGCAGCTGActttctAATGCAAGCGGATGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 18-bp frameshift deletion in exon 2.
Proper citation: RRID:RGD_5131954 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5144105
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Alternate IDs: 5144105
Notes: This strain was produced by injecting ZFNs targeting the sequence CAGCCCACTCGGCCCggcctcTCCCCGCGCCCGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 3.
Proper citation: RRID:RGD_5144105 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5144103
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Alternate IDs: 5144103
Notes: This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 4.
Proper citation: RRID:RGD_5144103 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5144102
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Alternate IDs: 5144102
Notes: This strain was produced by injecting ZFNs targeting the sequence agccacctggtatttgaggagacgcttggagatgac into ACI.FHH(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90) embryos. The result is a 5-bp frameshift deletion in exon 2.
Proper citation: RRID:RGD_5144102 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5144108
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Alternate IDs: 5144108
Notes: This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 4.
Proper citation: RRID:RGD_5144108 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5144101
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryorecovery (as of 2017-01-26)
References:
Synonyms:
Alternate IDs: 5144101
Notes: This strain was produced by injecting ZFNs targeting the sequence GTCTGCAGGCTGCCGCagcaagTACGTGGGCATCTGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 3.
Proper citation: RRID:RGD_5144101 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131094
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 5131094
Notes: Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.
Proper citation: RRID:RGD_5131094 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5143994
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Alternate IDs: 5143994
Notes: This strain was produced by injecting ZFNs targeting the sequence GCCCGCGTCATCCGAtagcagCACCAAAAGGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 142-bp deletion, overlapping the start codon
Proper citation: RRID:RGD_5143994 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5143996
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Alternate IDs: 5143996
Notes: This strain was produced by injecting ZFNs targeting the sequence ATCCTGGCCCTGGGTgtgtggGCTGTGGCCCAGCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 100-bp mutation deleting part of exon 3 and the splice acceptor.
Proper citation: RRID:RGD_5143996 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131933
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 5131933
Notes: This strain was produced by injecting ZFNs targeting the sequence CGAGTGGGCCATgtgggCCAACGAACAGGCGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 36-bp frameshift deletion in exon 1.
Proper citation: RRID:RGD_5131933 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5508370
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Alternate IDs: 5508370
Notes: This strain was produced by injecting ZFNs targeting the sequence TTCCCAATTCGTCACAgaagctGCTGGAGCTGATAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 100-bp deletion of part of intron 1 and exon 2.
Proper citation: RRID:RGD_5508370 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5508371
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Alternate IDs: 5508371
Notes: This strain was produced by injecting ZFNs targeting the sequence GCCCCAGCCATGCTGTGCtatgtGACGAGGCCGGACGCGGTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 51-bp frameshift deletion in exon 1.
Proper citation: RRID:RGD_5508371 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6484562
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Alternate IDs: 6484562
Notes: This strain was produced by injecting ZFNs targeting the sequence TGGATCCCACGAAGCcagtgtGTTAAGTAAGTTGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in exon 1.
Proper citation: RRID:RGD_6484562 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6484564
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 6484564
Notes: This strain was produced by injecting ZFNs targeting the sequence CTCGCCTGCATCCTTCAAGtgcagtTCCCAGGAGCAGGTAAGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 1.
Proper citation: RRID:RGD_6484564 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5686788
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2018-09-05)
References:
Synonyms:
Alternate IDs: 5686788
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5686788 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5686306
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 5686306
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5686306 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5686300
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2019-07-26)
References:
Synonyms:
Alternate IDs: 5686300
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5686300 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5686784
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2018-09-05)
References:
Synonyms:
Alternate IDs: 5686784
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5686784 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
