Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=629020173
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 629020173
Notes: The Cre recombinase gene was knocked into exon 2 of the Drd2 gene using CRISPR/Cas9 genome editing. RRRC:00979
Proper citation: RRID:RGD_629020173 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=626168248
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Live Animals (as of 2025-08-28)
References:
Synonyms:
Alternate IDs: 626168248
Notes: The CRISPR/Cas9 system was used to delete the FIRE ( Fms intronic regulatory element) enhancer of the Csf1r gene of LE rat embryos Clare Pridans
Centre for Inflammation Research
Institute for Regeneration and Repair
The University of Edinburgh
Proper citation: RRID:RGD_626168248 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405100723
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 405100723
Notes: The CRISPR/Case9 knock-in of CAG-LSL-Ghsr (LSL: loxp-Stop-Loxp) to the ROSA 26 locus of LE rats has cre recombinase-dependent expression of rat Ghsr under the control of CAG promoter. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature.
Proper citation: RRID:RGD_405100723 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=625777900
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Embryo (as of 2025-08-06)
References:
Synonyms:
Alternate IDs: 625777900
Notes: Ugt2 (cluster) KO strain: The Ugt2 cluster was disrupted using the genome editing technology CRISPR/Cas9, and F1 rats (heterozygotes) were produced by crossing with Wistar (Crlj:WI) rats. The F1 rats were then crossed with each other to produce a homozygous strain. Ugt2 KO map Tc (UGT2-MAC) strain (Tc: transchromosomic): After introducing UGT2-MAC into rat ES cells (BLK2i-1), chimera rats were produced, which were then crossed with Wistar rats to produce F1 transmission rats, and further crossed with Wistar rats for several generations to produce strain rats. The MAC vector consists of the following genes: HPRT gene full length sequence, bovine growth hormone (BGH) polyA signal, b-actin promoter, b-globin insulator, CMV-IE enhancer, SV40 polyA signal, loxP sequence, FRT sequence, ampicillin resistance gene, neomycin resistance gene, kanamycin resistance gene, puromycin resistance gene, green fluorescent protein (GFP) gene and its mutants, PGK promoter, mouse chromosome 11 centromere region Tc (UGT2-MAC)-UGT2 strain: The strain was created by crossing the Tc(UGT2-MAC) strain with the Ugt2 (cluster) KO strain. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_625777900 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=19165364
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Live Animals (as of 2026-03-05)
References:
Synonyms:
Alternate IDs: 19165364
Notes: Cas9 protein and sgRNA targeting the sequence CCTTTTTGCAGAGCACGAAA within exon 2 of Adcy3 were injected into embryos of the WKY/NCrl strain. A 3-bp deletion resulted (rn7: chr6:27,126,062-27,126,064). Contact Dr. Solberg-Woods at Wake Forest University School of Medicine, Email: [email protected]
Proper citation: RRID:RGD_19165364 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=152999023
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 152999023
Notes: Applied StemCell, Inc (Milpitas, CA) was contracted to generate the Iba1-EGFP knock-in rat model using
CRISPR/Cas9 technology in the Sprague Dawley rat strain. The donor construct inserted consisted of the
EGFP coding sequence (minus the first ATG), followed by the 22 amino acid sequence of the porcine
teschovirus-1 2A (P2A) self-cleaving peptide, and then the first exon of the rat Iba1 gene immediately
downstream of the translational start site. Guide RNA with the following sequence: 5'- TACCCTGCAAATCCTTGCTCTGG-3' targeting the Iba1 gene just
downstream of the translational start site were used.
Proper citation: RRID:RGD_152999023 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=629464
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 629464
Notes: This fatty zucker is derived from Lois and Theodore Zucker colonies from which Research colonies were established at many institutions.
Proper citation: RRID:RGD_629464 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=629463
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 629463
Notes: This is the littermate of ZUC-LeprfaSte-/-. The fa mutation occurred spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960. This was observed during genetic experiments related to coat color and body size. These rats have lean phenotype.
Proper citation: RRID:RGD_629463 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10045582
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Embryo; Cryopreserved Sperm
References:
Synonyms:
Alternate IDs: 10045582
Notes: This strain shows malocclusion. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_10045582 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10002787
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 10002787
Notes: Several rats curled arose spontaneously in a closed colony of SD rats maintained at Laboratory Animal Center of Zhengzhou University. a 3 bp deletion at position 420-422 of Krt71 which results in the deletion of aspartate was identified.
Proper citation: RRID:RGD_10002787 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10002791
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 10002791
Notes: This strain was produced by injecting TALENs targeting the sequence CTCAGTGTTCCTACTCTgcccctcccagaggttcaATGCTTTGTGTTCAATGTCG into Crl:SD rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 3. Availability contact: [email protected]
Proper citation: RRID:RGD_10002791 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054414
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Alternate IDs: 10054414
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Mmp9 gene of SS/JrHsdMcwi rat embryos. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_10054414 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=61113
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 61113
Notes: These were derived by introgressing mutant Lx gene of the polydactylous rat onto the BN background.
Proper citation: RRID:RGD_61113 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10053598
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 10053598
Notes: Foxn1 mutation was induced by injecting pX330 expressing Cas9 and sgRNA targeting the sequence GACTGGAGGGCGAACCCCAA into Crlj:WI rat embryos. The resulting mutation is a 44-bp frameshift deletion in exon 1 (del 54-97). Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN
Proper citation: RRID:RGD_10053598 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10047085
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 10047085
Notes: CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+Oligo was injected into zygote of SD rat. The mutation changed the 521th amino acid Arg (R) into Cys (C). Institute of Neuroscience, Chinese Academy of Sciences
Proper citation: RRID:RGD_10047085 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054386
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2018-11-26)
References:
Synonyms:
Alternate IDs: 10054386
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Chrna5 gene of LEW/NCrl rat embryos. The resulting mutation is a 1-bp insertion in the Chrna5 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_10054386 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054383
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2018-11-26)
References:
Synonyms:
Alternate IDs: 10054383
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Chrna4 gene of LEW/NCrl rat embryos. The resulting mutation is a 16-bp deletion in the Chrna4 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_10054383 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054398
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Live Animals; Cryopreserved Sperm (as of 2018-10-22)
References:
Synonyms:
Alternate IDs: 10054398
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Gla gene of DA/OlaHsd rat embryos. The resulting mutation is a 47-bp deletion in the Gla gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_10054398 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054401
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Live Animals; Cryopreserved Sperm (as of 2018-10-22)
References:
Synonyms:
Alternate IDs: 10054401
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Helz2 gene of FHH-Chr 3BN/Mcwi rat embryos.The resulting mutation is a 11-bp deletion in the Helz2 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_10054401 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054376
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2018-11-26)
References:
Synonyms:
Alternate IDs: 10054376
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Chrna3 gene of LEW/NCrl rat embryos. The resulting mutation is a 17-bp deletion in the Chrna3 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_10054376 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
