Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
F344-Hcn1em2Kyo Resource Report Resource Website |
RRID:RGD_38676251 | Rattus norvegicus | TALEN (Left: ttcagAATGATTCATGGG, Right : ACGCACTCTTCAAAGCTA) targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 24-bp deletion in the exon4 of Hcn1 gene. It is predicted that 8 amino-acid deleted HCN1 protein is expressed. National BioResource Project for the Rat in Japan | 38676251 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2020-09-16) | 38676251 | 2026-07-25 12:43:09 | 0 | |||||
|
SD-Del(Yp)1Mcwi Resource Report Resource Website |
RRID:RGD_155663364 | Rattus norvegicus | CRISPR guide RNAs flanking Sry4a and Sry1 (Sry) on the Y-chromosome were injected into Crl:SD strain embryos. Chromosomal deletions have not been explicitly defined. | 155663364 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2022-11-11) | 155663364 | 2026-07-25 12:43:11 | 0 | |||||
|
SD-Spon2em1Holi Resource Report Resource Website |
RRID:RGD_329333019 | Rattus norvegicus | This Spon2 knockout mutant was produced by injecting TALENs targeting exon 2 of rat Spon2 into Sprague Dawley embryos. Founder #4-1 (a1) carrying a 22-bp deletion was chosen to produce heterozygous and homozygous rats. | 329333019 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 329333019 | 2026-07-25 12:43:11 | 0 | |||||
|
SD-Ddah1em1Ywxu Resource Report Resource Website |
RRID:RGD_151347605 | Rattus norvegicus | CRISPR-Cas9 technique was used to generate DDAH1-/- rats on Sprague-Dawley background. Genome deletion in exon 1 was confirmed by PCR analysis with the primers:DDAH1-F (5'-GCGCTGCTCTCGGGAAGA-3') and DDAH1-R (5'-GGGTGATGAGGGCGGTCT-3'). | 151347605 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 151347605 | 2026-07-25 12:43:10 | 0 | |||||
|
SS-Chr 3BN.Il2rgem1Mcwi/Mcwi Resource Report Resource Website |
RRID:RGD_155791425 | Rattus norvegicus | The IL2Rg gene was targeted in the SS/JrHsdMcwi rat by TALEN injection into single-cell rat embryos. Once established, a homozygous (RGD:12790632) female rat from the SSIL2Rg line was intercrossed with a homozygous SS.BN3 (RGD:1358154) male to yield heterozygous SS.BN3IL2Rg offspring (F1), followed by brother-sister mating to yield homozygous SS. BN3IL2Rg offspring by the F3 generation. This strain is Immunodeficient Ilrg (X-SCID) mutant consomic line. | 155791425 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 155791425 | 2026-07-25 12:43:10 | 0 | |||||
|
SD-Bmal1em1Mcwi Resource Report Resource Website |
RRID:RGD_155598601 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a 58-base pair deletion in exon 6 in the rat Bmal1 gene of Crl:SD embryos. The deletion caused a premature stop codon in exon 6 resulting in a severe truncation of the Bmal1 protein. Contact MCW rat distribution at [email protected] | 155598601 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 155598601 | 2026-07-25 12:43:11 | 0 | |||||
|
SD-Pde6bem1Cgen Resource Report Resource Website |
RRID:RGD_155631289 | Rattus norvegicus | This mutant strain was generated by microinjecting CRISPRs/Cas9 system targeting rat Pde6b. Pde6b knock out rat was successfully created. Cyagen Biosciences Inc, Santa Clara, CA, USA | 155631289 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 155631289 | 2026-07-25 12:43:11 | 0 | |||||
|
CD-Ctnsem3Vjupk Resource Report Resource Website |
RRID:RGD_155630633 | Rattus norvegicus | The mutant rat was produced by injecting Crl:CD(SD) zygotes with gRNA +Cas9 ribonucleoprotein complex targeting exon 3 of rat Ctns. The founder of this strain possessed a 8-bp insertion which results in frameshift and pre-mature stop truncated protein. | 155630633 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 155630633 | 2026-07-25 12:43:10 | 0 | |||||
|
SD-Flnaem1Ang Resource Report Resource Website |
RRID:RGD_155631278 | Rattus norvegicus | This mutant strain was generated by electroporating rat zygotes with CRISPRs/Cas9 system targeting exon12 of rat Flna into Crl:SD embryo. This mutant strain carries P637Q knock in the gene. | 155631278 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 155631278 | 2026-07-25 12:43:11 | 0 | |||||
|
F344-Txn1m1Kyo Resource Report Resource Website |
RRID:RGD_288084580 | Rattus norvegicus | This mutation Phe54Leu is an autosomal dominant mutation that appeared in a stock of F344/NSlc rats that had been mutagenized with N-ethyl-N-nitrosourea (ENU). Rats heterozygous for Txn1 (Txn1 /+) exhibited running seizures only in its juvenile stage. The rat called Adem rat, exhibited age dependent mitochondrial cytopathy (Adem). The rats were backcrossed for more than ten generations on the F344/NSlc inbred background to ensure other mutations induced by ENU was reduced. The causative gene was identified as a missense substitution (c. 160 T > C, p. Phe54Leu) in exon 3 of Txn1. | 288084580 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 288084580 | 2026-07-25 12:43:11 | 0 | |||||
|
SD-Mecp2em1Sage/Hsd Resource Report Resource Website 1+ mentions |
RRID:RGD_156430169 | Rattus norvegicus | The MeCP2 KO rat model was originally created at SAGE Labs, Inc. in St. Louis, MO and distributed out of the Boyertown, PA facility. The line continues to be maintained through the original SAGE Labs animal inventory acquired by Envigo. The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Mecp2 into Sprague Dawley embryos. This mutant rat has a knockout of the methyl CpG binding protein 2 (Mecp2). ENVIGO | 156430169 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2023-02-22) | 156430169 | 2026-07-25 12:43:10 | 2 | |||||
|
SS-Chr 3BN.SS-(D3Rat 86-D3Rat218).Il2rgem1/Mcwi Resource Report Resource Website |
RRID:RGD_155791440 | Rattus norvegicus | Immunodeficient subcongenic line developed by intercross SS-Chr 3BN.SS-(D3Rat222-D3Rat218).Il2rgem1Mcwi/Mcwi (RGD:155791433) heterozygous congenic, Il2rg null mutant (X-SCID) lines. Contact MCW rat distribution at [email protected] for availability. | 155791440 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 155791440 | 2026-07-25 12:43:12 | 0 | |||||
|
WI;WDB-ROSA26tm1(H2B-tdTomato)/Nips Resource Report Resource Website |
RRID:RGD_155269039 | Rattus norvegicus | PCR products of the human H2BC11 (H2B-6), tdTomato, splice acceptor sequence, and IRES-Neor-SV40pA were inserted into the NheI site of prROSA26-1 with an in-fusion cloning kit. The final tdTomato-H2B-6 targeting vector was linearized by SalI digestion. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by electroporation. Targeted ES cells were injected into Crlj:WI (RGD ID: 2312504) blastocysts to produce chimeric rats. The chimeric rats were crossed with Crlj:WI rats to produce heterozygous founder rats.These rat strains are being maintained by crossing the founder rats with Crlj:WI rats. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN | 155269039 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2022-10-11) | 155269039 | 2026-07-25 12:43:12 | 0 | |||||
|
SS-Del(1q)2Mcwi Resource Report Resource Website |
RRID:RGD_404976873 | Rattus norvegicus | Four single guide RNAs and SpCas9 targeting sequences CTTCATTGTATGAGCAGCCG, TTTGAAAGAGACAGCTGCCT, ACGCACGTCGGACAGTTCCA, and GGCTTATTGCGCACGCACGT flanking a chromosome 1 region were targeted in SS/JrHsdMcwi embryos. An 82-bp deletion in chromosome 1 (rn7: chr1:255,749,164-255,749,245) resulted. Please contact: [email protected] | 404976873 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2024-03-18) | 404976873 | 2026-07-25 12:43:12 | 0 | |||||
|
SS-Mmp2em2Mcwi+/+ Resource Report Resource Website |
RRID:RGD_5688037 | Rattus norvegicus | ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. | (null) | (null) | 5688037 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 5688037 | 2026-07-25 12:43:12 | 0 | |||
|
SS-Mmp2em2Mcwi-/- Resource Report Resource Website |
RRID:RGD_5688034 | Rattus norvegicus | ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. | (null) | (null) | 5688034 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2017-07-18) | 5688034 | 2026-07-25 12:43:12 | 0 | |||
|
SD-Foxo4em1Soar Resource Report Resource Website |
RRID:RGD_405855876 | Rattus norvegicus | This Foxo4 mutant strain was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 2 (target sequence: CCAGATATACGAATGGATGGTCC; nucleotides 517-539) and exon 3 (target sequence: GTTCATCAAGGTACATAACGAGG; nucleotides 631-653) of the Foxo4 gene (NM_001106943.1)) were injected to the embryos to create a 3096-bp deletion including the 3' part of exon 2 and 5' part of exon 3, and resulting a premature stop of the protein. | 405855876 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 405855876 | 2026-07-25 12:43:12 | 0 | |||||
|
LEW-Chrna4em5Mcwi Resource Report Resource Website |
RRID:RGD_12790615 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Chrna4 gene of LEW/Crl rat embryos. The resulting mutation is a 4-bp deletion in the Chrna4 gene. Contact MCW rat distribution at [email protected] | 12790615 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryorecovery (as of 2017-02-17) | 12790615 | 2026-07-25 12:43:12 | 0 | |||||
|
SS-Cd247em1Mcwi Resource Report Resource Website 1+ mentions |
RRID:RGD_6484582 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CTCGCCTGCATCCTTCAAGtgcagtTCCCAGGAGCAGGTAAGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 1. | 6484582 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 6484582 | 2026-07-25 12:43:12 | 1 | |||||
|
LE-Fmr1em1Sidb Resource Report Resource Website |
RRID:RGD_405100226 | Rattus norvegicus | Colony founders were produced by SAGE (Sigma Advanced Genetic Engineering) Labs using ZFN-mediated disruption of Fmr1 with a targeted construct containing coding sequence for eGFP; resulting founders did not express FMRP or eGFP. Simons Initiative for the Developing Brain (SIDB), Institute for Neuroscience and Cardiovascular Research, University of Edinburgh, Edinburgh EH8 9XD, UK. Contact SIDB Scientific Officer for enquiries on rat distribution ([email protected]). | 405100226 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 405100226 | 2026-07-25 12:43:12 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
