Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
CD-Slc30a10em1Sommu Resource Report Resource Website |
RRID:RGD_401795484 | Rattus norvegicus | Exon 1 of Slc30a10 was targeted using CRISPR/Cas9 in the Crl:CD(SD) embryos . A mosiac founder that transmitted a 248 bp deletion in exon 1 of Slc30a10 leading to an out of frame mutation after amino acid 22 was bred to a CD rat to select for the above deletion and establish the line. The strain will be deposited to RRRC. | 401795484 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2023-09-11) | 401795484 | 2026-07-25 12:43:12 | 0 | |||||
|
SD-Esr1em1Bra+/+ Resource Report Resource Website |
RRID:RGD_405650195 | Rattus norvegicus | This is the wild type littermate from the crossing of heterozygous Esr1 mutant rats. This wild type littermate rat was used as a control for the homozygous mutant SD-Esr1em1-/- (RGD:405649860) in estrogen receptor study. Department of Medicine, Division of Pulmonary, Critical Care, Sleep and Occupational Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA. | 405650195 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 405650195 | 2026-07-25 12:43:12 | 0 | |||||
|
F344-Nox4em1Shmo Resource Report Resource Website |
RRID:RGD_598092602 | Rattus norvegicus | A one-base insertion was introduced into the first exon of the NADPH oxidase 4 (Nox4) gene of F344/DuCrj rats by CRISPR/Cas9. They were then backcrossed to F344/N (Japan SLC, Inc.). National BioResource Project for the Rat in Japan | 598092602 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-03-28) | 598092602 | 2026-07-25 12:43:13 | 0 | |||||
|
F344-Cybbem1ShmoNox1em1ShmoNox4em1Shmo Resource Report Resource Website 1+ mentions |
RRID:RGD_598092603 | Rattus norvegicus | A 7-base deletion in the first exon of the NADPH oxidase 2 (Nox2) gene, a 29-base deletion in the first exon of the NADPH oxidase 1 (Nox1) gene, and a one-base insertion in the first exon of the NADPH oxidase 4 (Nox4) gene were introduced by CRISPR/Cas9 in the F344/DuCrj rats. They were then backcrossed to F344/N (Japan SLC, Inc.). This triple Nox knock rats were created by compound crossbreeding of single knockout rats (RGD:598092598, RGD:598092601, RGD:598092602). National BioResource Project for the Rat in Japan | 598092603 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-03-28) | 598092603 | 2026-07-25 12:43:13 | 1 | |||||
|
F344-Cybbem1Shmo Resource Report Resource Website |
RRID:RGD_598092601 | Rattus norvegicus | A 7-base deletion was introduced into the first exon of the NADPH oxidase 2 (Nox2)(official symbol:Cybb) gene of F344/DuCrj rats by CRISPR/Cas9. They were then backcrossed to F344/N (Japan SLC, Inc.). National BioResource Project for the Rat in Japan | 598092601 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-03-28) | 598092601 | 2026-07-25 12:43:13 | 0 | |||||
|
F344-Hspa8em2Opu Resource Report Resource Website |
RRID:RGD_598092577 | Rattus norvegicus | The Hspa8 mutation (c.284T>A) in the KK rat (NBRP Rat No. 0890) was inserted into the F344/Jcl. Knocking in of the mutant allele was performed by lsODN-mediated knock-in with the CRISPR-Cas9 system. The gRNA and PAM sequences are gtgccacaagctattaaatatatgg (PAM: tgg) and ccatttatggatgggctctctccc (PAM: cca). In KI rats, each PAM sequence is replaced by a silent mutation. Two lines were obtained from founder rats. In line 2, there are two SNPs in the intron where the upstream gRNA, but this is not related to the phenotype. This strain was produced with the support of the AdAMS (Advanced Animal Model Support). National BioResource Project for the Rat in Japan | 598092577 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-03-27) | 598092577 | 2026-07-25 12:43:13 | 0 | |||||
|
F344-Hspa8em1Opu Resource Report Resource Website |
RRID:RGD_598092574 | Rattus norvegicus | The Hspa8 mutation (c.284T>A) in the KK rat (NBRP Rat No. 0890)(RGD:598092575) was inserted into the F344/Jcl. Knocking in of the mutant allele was performed by lsODN-mediated knock-in with the CRISPR-Cas9 system. The gRNA and PAM sequences are gtgccacaagctattaaatatatgg (PAM: tgg) and ccatttatggatgggctctctccc (PAM: cca). In KI rats, each PAM sequence is replaced by a silent mutation. Two lines were obtained from founder rats. In line 1, there is one SNP in the intron where the upstream gRNA, but this is not related to the phenotype. This strain was produced with the support of the AdAMS (Advanced Animal Model Support). National BioResource Project for the Rat in Japan | 598092574 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-03-27) | 598092574 | 2026-07-25 12:43:13 | 0 | |||||
|
LEW-Col7a1em1Jtol-/- Resource Report Resource Website |
RRID:RGD_598130079 | Rattus norvegicus | The CRISPR/Cas9 system was used to introduce an 8-bp deletion in exon 1 of the Col7a1 gene of one-cell Lew/Crl rat embryos. The strain is deposited with RRRC (Rat Resource and Research Center) | 598130079 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2025-04-15) | 598130079 | 2026-07-25 12:43:13 | 0 | |||||
|
SS-Del(2q)1Mcwi -/- Resource Report Resource Website 1+ mentions |
RRID:RGD_401938598 | Rattus norvegicus | Four single guide RNAs and SpCas9 targeting sequences ATGAAGTGCCTAGCTTCATT, GAAGCTAGGCACTTCATCTA, ATTCATAATGGGACACTCGA, and CCCAGCCTCAGATTCATAAT flanking a chromosome 2 region distal to Npr3 were targeted in SS/JrHsdMcwi embryos. A 29,508 bp deletion in chromosome 2 (rn6: chr2:61,845,176-61,874,684) resulted, along with an insertion of 3 nucleotides (TGG). Please contact: [email protected] | 401938598 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2023-12-12) | 401938598 | 2026-07-25 12:43:13 | 1 | |||||
|
SD-Foxo4em1Soar+/+ Resource Report Resource Website |
RRID:RGD_405855877 | Rattus norvegicus | This is the wild type littermate from crossing of heterozygous mutant female rats with wild-type male rats to generate hemizygous null male rats and wild type mutant. Foxo4 mutant strain (RGD:405855876) was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 2 (target sequence: CCAGATATACGAATGGATGGTCC; nucleotides 517-539) and exon 3 (target sequence: GTTCATCAAGGTACATAACGAGG; nucleotides 631-653) of the Foxo4 gene (NM_001106943.1)) were injected to the embryos to create a 3096-bp deletion including the 3' part of exon 2 and 5' part of exon 3, and resulting a premature stop of the protein. | 405855877 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 405855877 | 2026-07-25 12:43:12 | 0 | |||||
|
LE-Them2-2(cre)Koba Resource Report Resource Website |
RRID:RGD_598092588 | Rattus norvegicus | The T2A, nlsCre, and BGHpolyA are knocked in at the stop codon in the 13th exon of the tyrosine hydroxylase (TH) gene (NCBI Gene ID: 25085). National BioResource Project for the Rat in Japan | 598092588 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-03-27) | 598092588 | 2026-07-25 12:43:13 | 0 | |||||
|
W-Mkxem2Asah Resource Report Resource Website |
RRID:RGD_598154597 | Rattus norvegicus | The CRISPR/Cas9 genome editing system targeting exon 2 of rat Mkx gene was injected to the Wistar embryo to generate this knock out rat strain with 7- bp deletion causing frameshift mutation in the gene. National BioResource Project for the Rat in Japan | 598154597 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-04-30) | 598154597 | 2026-07-25 12:43:13 | 0 | |||||
|
SD.LIS-ROSA26tm1(CAG-RCaMP2)Ksak Resource Report Resource Website |
RRID:RGD_598092586 | Rattus norvegicus | The ES cell line derived from Lister Hooded rats (Seac:LIS), which was established by Prof. Sakimura at Department of Animal Model Development, Brain Research Institute, Niigata University, was used. Cloned ES cells established by introducing a vector of RCaMP2-flox stop at the Rosa26 locus were injected into fertilized eggs of SD rats (Slc:SD) using a microinjection method. RCaMP2 stands for red calcium indicator (PMID: 25419959). National BioResource Project for the Rat in Japan | 598092586 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-03-27) | 598092586 | 2026-07-25 12:43:13 | 0 | |||||
|
F344-Il2rgem1Larc Resource Report Resource Website |
RRID:RGD_598154599 | Rattus norvegicus | This strain was generated at the Institute of Medical Science, University of Tokyo, by using CRISPR-Cas3. Microinjected into pronuclear-stage rat embryos of the F344/Jcl strain. The embryos were transferred into the oviducts of pseudopregnant females. A strain with a 1,869 bp deletion in the Il2rg gene was established from the resulting litters. National BioResource Project for the Rat in Japan | 598154599 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2025-04-30) | 598154599 | 2026-07-25 12:43:13 | 0 | |||||
|
SD-Pbkem1Dfult Resource Report Resource Website |
RRID:RGD_598092510 | Rattus norvegicus | we used CRISPR-Cas9 technology to generate a PBK KO rat. Cas9 editing of exon 4 in the rat PBK gene resulted in the insertion of a single “T” resulting in a frame shift and premature termination of the PBK protein. PMCID: PMC11650665 Availability Contact Email: [email protected] at Augusta University | 598092510 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm (as of 2025-03-21) | 598092510 | 2026-07-25 12:43:13 | 0 | |||||
|
WI-C1ql3em1Lian Resource Report Resource Website 1+ mentions |
RRID:RGD_408364982 | Rattus norvegicus | The C1ql3 knout rats were established using CRISPR/cas9 method. The exon 1 of C1ql3 was targeted with two sgRNAs of (TCATC CTC ATC CCG GTG CTGG) and (AAGGT GCT GAC AAG AGG GAGG), which, respectively, targeted on the 5′ end and the 3′ end of exon 1.Wistar embryos born from Sprague Dawley pseudo-pregnant female were genotyped by polymerase chain reaction (PCR) with two upstream primers of (5′-TCCAAAAG CAG ACA AGA GGATC-3′ and 5′-CTACTTCT TCA CCT ACC ACG TCCTG-3′) and one downstream primer (5′-GGCTTCTG AAA CCT TAT ACA TTCTCG-3′). This mutant carried a 631-bp deletion resulting a premature stop at 61 bp of the open reading frame. National Human Disease Animal Model Resource Center, Beijing, China (https://namr.org.cn/Ldesc/1_1074) | 408364982 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2024-11-08) | 408364982 | 2026-07-25 12:43:13 | 3 | |||||
|
F344-ROSA26em20(Alb-cre)Larc Resource Report Resource Website |
RRID:RGD_616336066 | Rattus norvegicus | F344/Jcl rat fertilized eggs were microinjected and then transplanted into the oviducts of pseudopregnant females. From the resulting offspring, rats with the Alb promoter-Cre sequence inserted into the ROSA26 gene were selected and established. The Alb promoter-Cre sequence is inserted in an inverted position. Cre is expressed specifically in the liver. National BioResource Project for the Rat in Japan | 616336066 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2025-05-14) | 616336066 | 2026-07-25 12:43:13 | 0 | |||||
|
F344-Albem4(cre)Larc Resource Report Resource Website 1+ mentions |
RRID:RGD_616336067 | Rattus norvegicus | Fertilized eggs from F344/Jcl rats were microinjected and then transplanted into the oviducts of pseudopregnant females. From the resulting offspring, rats with the 2A-Cre sequence inserted into the Albumin gene were selected and established. National BioResource Project for the Rat in Japan | 616336067 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-05-14) | 616336067 | 2026-07-25 12:43:13 | 1 | |||||
|
F344-ROSA26em10(Alb-cre)Larc Resource Report Resource Website |
RRID:RGD_616336065 | Rattus norvegicus | F344/Jcl rat fertilized eggs were microinjected and then transplanted into the oviducts of pseudopregnant females. From the resulting offspring, rats with the Alb promoter-Cre sequence inserted into the Rosa26 gene were selected and established. Although the Alb promoter is inserted, cre leakage is confirmed throughout the body. National BioResource Project for the Rat in Japan | 616336065 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-05-14) | 616336065 | 2026-07-25 12:43:13 | 0 | |||||
|
LE-Them2-1(cre)Koba Resource Report Resource Website |
RRID:RGD_598092591 | Rattus norvegicus | The T2A, nlsCre, and BGHpolyA are knocked in at the stop codon in the 13th exon of the tyrosine hydroxylase (TH) gene (NCBI Gene ID: 25085). National BioResource Project for the Rat in Japan | 598092591 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-03-27) | 598092591 | 2026-07-25 12:43:13 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
