Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405100226
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 405100226
Notes: Colony founders were produced by SAGE (Sigma Advanced Genetic Engineering) Labs using ZFN-mediated disruption of Fmr1 with a targeted construct containing coding sequence for eGFP; resulting founders did not express FMRP or eGFP. Simons Initiative for the Developing Brain (SIDB), Institute for Neuroscience and Cardiovascular Research, University of Edinburgh, Edinburgh EH8 9XD, UK. Contact SIDB Scientific Officer for enquiries on rat distribution ([email protected]).
Proper citation: RRID:RGD_405100226 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155791439
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 155791439
Notes: Immunodeficient subcongenic line developed by intercross SS-Chr 3BN.SS-(D3Rat222-D3Rat218).Il2rgem1Mcwi/Mcwi (RGD:155791433) heterozygous congenic, Il2rg null mutant (X-SCID) lines. Contact MCW rat distribution at [email protected] for availability.
Proper citation: RRID:RGD_155791439 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329849011
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2023-06-09)
References:
Synonyms:
Alternate IDs: 329849011
Notes: SD rats (Slc:SD) in which the c-Fos gene (ENSRNOG00000008015) was disrupted by the CRISPR/Cas9 system. Two guide RNAs and Cas9 protein were injected into the pronucleus of fertilized eggs of SD rats. After injection, they were transferred into the oviducts of the recipient rats and born. The founder rat (line 12) showed abnormal teeth, and PCR and sequencing analysis revealed that 1,067 bases including Exon 1 were deleted. The founder rat were mated with SD rats and bred. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_329849011 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401938647
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Live Animals (as of 2023-12-18)
References:
Synonyms:
Alternate IDs: 401938647
Notes: Crispr-Cas was used to introduce a 2bp insertion of TT to create a stop codon in exon 7 of SLC9a6 gene, causing termination of translation. The strain was rederived at RRRC. deposited at RRRC
Proper citation: RRID:RGD_401938647 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329849009
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2023-06-09)
References:
Synonyms:
Alternate IDs: 329849009
Notes: F344-TyrC KitH/Kyo (Black F344, NBRP Rat No. 0768, aka RGD:11040971), carrying 1) point mutation in the exon 2 (896G>A, p.R229H) of Tyrosinase (Tyr) gene (albino phenotype) and 2) retrotransposon insertion (7-bp) in kit gene (hooded phenotype) induced was crossed with F344/NSlc (Japan SLC, Inc.). Then, from the F2 generation, Tyr as a wild-type homozygous (confirmed by sequence) and Kit as a hooded homozygous (confirmed by phenotype) were selected. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_329849009 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329849003
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 329849003
Notes: A complex of Cas9 protein and gRNA was introduced into Iar:LE fertilized rat eggs by electroporation. Combi-CRISPR (Yoshimi K. et al.) was used to induce knock-in. Knock-in rats were selected and crossed with wild-type rats to establish this strain. Sequence features: the intron just before the fourth exon of the Pvalb gene (intron 3) is deleted by NHEJ after double-strand break by one base compared to the wild-type. ---ttggcgggccagaacctcagggg---(wild-type) ---ttggcgggccagaacc-cagggg---(knock-in) National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_329849003 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329845600
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 329845600
Notes: Genome editing was performed using the rGONAD method to produce three different lines of KO rats due to three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene This em3 mutant carries a deletion of 56 base pairs containing the first methioine. Col4α5 em3 ratshave urinary protein and hematuria from early on, and males begin to die at 18 weeks of age and all die by 28 weeks of age. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_329845600 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054373
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown (as of 2018-10-22)
References:
Synonyms:
Alternate IDs: 10054373
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Chrna3 gene of LEW/NCrl rat embryos.The resulting mutation is a 1-bp (G) insertion in the Chrna3 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_10054373 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155631298
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 155631298
Notes: The rat mutant was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the catalytic domain in the rat Pde3a gene. The model has a carriesa CGT to TGD missense mutation and results in R862C substitutions in the protein
Proper citation: RRID:RGD_155631298 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401940197
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 401940197
Notes: The Ahr heterozygous rats were created using CRISPR/Cas9 gene editing to delete 10 bp of exon 2 of Ahr in Sprague Dawley rats .
Proper citation: RRID:RGD_401940197 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405849408
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 405849408
Notes: CRISPR/Cas9 system was used to introduce a 7-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos. This is a heterozygous strain which has decreased Xdh protein detected in the kidney cortex tissue as compared to the wild type littermate at 6-week old. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_405849408 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401717572
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Live Animals (as of 2023-08-07)
References:
Synonyms:
Alternate IDs: 401717572
Notes: CRISPR/SpCas9 system using sgRNA targeting the sequence CAGGGCCACGTGCAGATAGTCGG was used to introduce an 11-bp deletion (rn7: chr10:72,595,923-72,595,933) in exon 4 of the Mpo gene in Crl:SD strain rats.
Proper citation: RRID:RGD_401717572 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155630635
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 155630635
Notes: The mutant rat was produced by injecting Crl:CD(SD) zygotes with gRNA +Cas9 ribonucleoprotein complex targeting exon 3 of rat Ctns. The founder of this strain possessed a 7-bp deletion which results in frameshift and pre-mature stop truncated protein.
Proper citation: RRID:RGD_155630635 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401940195
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 401940195
Notes: The homozygous knockout rats were created using CRISPR/Cas9 gene editing to delete 10 bp of exon 2 of Ahr in Sprague Dawley rats .
Proper citation: RRID:RGD_401940195 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5688032
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration: (null)
Availability: Unknown
References:
Synonyms:
Alternate IDs: 5688032
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5688032 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10759544
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 10759544
Notes: this strain was produced by CRISPR/Cas9 system. The resulting knock-in mutation is R411W in exon 11 of the GCDH gene.
Proper citation: RRID:RGD_10759544 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329969883
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 329969883
Notes: A pair of synthetic oligonucleotides for sgRNA (sgRNA1, CCTTGCCGCTTTAAGTGACTC; sgRNA2, CCATGTTGGGAGCATTGCCTA) were annealed and then cloned into the pUC57-sgRNA expression vector, and the floxed plasmid donor was cloned into the pGSI plasmid. Both the Cas9 and sgRNA expression plasmids were linearized and used as templates for in vitro transcription. A mixture of the donor vector (4ââ¬â¦ng/ul), Cas9 mRNA (25ââ¬â¦ng/ul), and sgRNAs (10ââ¬â¦ng/ul each) was microinjected into both the cytoplasm and male pronucleus of the fertilized eggs. The injected zygotes were then transferred to pseudopregnant SD rats, which then carried them to parturition. This is called conditional knockout Trim44 (Trim44 cKO).
Proper citation: RRID:RGD_329969883 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401824639
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2025-11-22)
References:
Synonyms:
Alternate IDs: 401824639
Notes: Produced by injection of CRISPR/Cas9 targeting the genomic sequence GGTGAGATCCTTTGAAAAGG in Rag1 into double homozygous embryos with knockout of Fah and Il2rg produced following multiple generations of intercrossing strains SD-Il2rgem2Mcwi (RGDID:10002794) and SD-Fahem3Mcw (RGDID: 10002791). The resulting CRISPR-induced mutation in Rag1 deletes 25-bp (rn7: chr3:87,923,384-87,923,408) and inserts 17 bp (ACCCTAAACAGCTGTGC) for a net 8-bp deletion. availability contact: [email protected]
Proper citation: RRID:RGD_401824639 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329848995
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2023-06-07)
References:
Synonyms:
Alternate IDs: 329848995
Notes: The kisspeptin gene (Kiss1) is knocked out conditonally by the Cre recombinase. This strain was generated by K.I. Maeda (The University of Tokyo), H. Tsukamura, Y. Uenoyama, N. Inoue (Nagoya University), and M. Hirabayashi (National Institute for Physiological Sciences) for the purpose of producing conditional knockout rats of the Kiss1 gene in the hypothalamus. The targeting vector (loxP, Kiss1[exons 2 and 3], PGK promoter-neo, loxP) was introduced by electroporation targeting the Kiss1 gene in ES cells (WDB/Nips-ES1/Nips). Crossed with and maintained by the Wistar-Imamichi rats (Iar:Wistar-Imamichi, Institute for Animal Reproduction). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_329848995 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329848994
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2023-06-21)
References:
Synonyms:
Alternate IDs: 329848994
Notes: Kiss1 knockout rats were generated by K.I. Maeda (The University of Tokyo), H. Tsukamura, Y. Uenoyama, N. Inoue (Nagoya University), and M. Hirabayashi (National Institute for Physiological Sciences). The targeting vector (tdTomato/puromycin N-acetyl transferase) was introduced by electroporation targeting the Kiss1 gene in ES cells (WDB/Nips-ES1/Nips). Crossed with and maintained by the Wistar-Imamichi rats (Iar:Wistar-Imamichi, Institute for Animal Reproduction). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_329848994 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
