Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 27 showing 521 ~ 540 out of 1,464 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:RGD_38676253

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38676253

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2020-09-16)
References:
Synonyms:
Alternate IDs: 38676253
Notes: TALEN (Left: ttcagAATGATTCATGGG, Right : ACGCACTCTTCAAAGCTA) targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 7-bp deletion in the exon4 of Hcn1 gene: as a result of frameshift mutation, stop codon is produced. Decreased expression levels of Hcn1 gene and HCN1 protein. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_38676253 Copy   


  • RRID:RGD_38676251

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38676251

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2020-09-16)
References:
Synonyms:
Alternate IDs: 38676251
Notes: TALEN (Left: ttcagAATGATTCATGGG, Right : ACGCACTCTTCAAAGCTA) targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 24-bp deletion in the exon4 of Hcn1 gene. It is predicted that 8 amino-acid deleted HCN1 protein is expressed. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_38676251 Copy   


  • RRID:RGD_155663364

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155663364

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Live Animals (as of 2022-11-11)
References:
Synonyms:
Alternate IDs: 155663364
Notes: CRISPR guide RNAs flanking Sry4a and Sry1 (Sry) on the Y-chromosome were injected into Crl:SD strain embryos. Chromosomal deletions have not been explicitly defined.

Proper citation: RRID:RGD_155663364 Copy   


  • RRID:RGD_329333019

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329333019

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 329333019
Notes: This Spon2 knockout mutant was produced by injecting TALENs targeting exon 2 of rat Spon2 into Sprague Dawley embryos. Founder #4-1 (a1) carrying a 22-bp deletion was chosen to produce heterozygous and homozygous rats.

Proper citation: RRID:RGD_329333019 Copy   


  • RRID:RGD_151347605

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=151347605

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 151347605
Notes: CRISPR-Cas9 technique was used to generate DDAH1-/- rats on Sprague-Dawley background. Genome deletion in exon 1 was confirmed by PCR analysis with the primers:DDAH1-F (5'-GCGCTGCTCTCGGGAAGA-3') and DDAH1-R (5'-GGGTGATGAGGGCGGTCT-3').

Proper citation: RRID:RGD_151347605 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155791425

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 155791425
Notes: The IL2Rg gene was targeted in the SS/JrHsdMcwi rat by TALEN injection into single-cell rat embryos. Once established, a homozygous (RGD:12790632) female rat from the SSIL2Rg line was intercrossed with a homozygous SS.BN3 (RGD:1358154) male to yield heterozygous SS.BN3IL2Rg offspring (F1), followed by brother-sister mating to yield homozygous SS. BN3IL2Rg offspring by the F3 generation. This strain is Immunodeficient Ilrg (X-SCID) mutant consomic line.

Proper citation: RRID:RGD_155791425 Copy   


  • RRID:RGD_155598601

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155598601

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 155598601
Notes: CRISPR/Cas9 system was used to introduce a 58-base pair deletion in exon 6 in the rat Bmal1 gene of Crl:SD embryos. The deletion caused a premature stop codon in exon 6 resulting in a severe truncation of the Bmal1 protein. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_155598601 Copy   


  • RRID:RGD_155631289

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155631289

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 155631289
Notes: This mutant strain was generated by microinjecting CRISPRs/Cas9 system targeting rat Pde6b. Pde6b knock out rat was successfully created. Cyagen Biosciences Inc, Santa Clara, CA, USA

Proper citation: RRID:RGD_155631289 Copy   


  • RRID:RGD_155630633

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155630633

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 155630633
Notes: The mutant rat was produced by injecting Crl:CD(SD) zygotes with gRNA +Cas9 ribonucleoprotein complex targeting exon 3 of rat Ctns. The founder of this strain possessed a 8-bp insertion which results in frameshift and pre-mature stop truncated protein.

Proper citation: RRID:RGD_155630633 Copy   


  • RRID:RGD_155631278

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155631278

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 155631278
Notes: This mutant strain was generated by electroporating rat zygotes with CRISPRs/Cas9 system targeting exon12 of rat Flna into Crl:SD embryo. This mutant strain carries P637Q knock in the gene.

Proper citation: RRID:RGD_155631278 Copy   


  • RRID:RGD_288084580

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=288084580

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 288084580
Notes: This mutation Phe54Leu is an autosomal dominant mutation that appeared in a stock of F344/NSlc rats that had been mutagenized with N-ethyl-N-nitrosourea (ENU). Rats heterozygous for Txn1 (Txn1 /+) exhibited running seizures only in its juvenile stage. The rat called Adem rat, exhibited age dependent mitochondrial cytopathy (Adem). The rats were backcrossed for more than ten generations on the F344/NSlc inbred background to ensure other mutations induced by ENU was reduced. The causative gene was identified as a missense substitution (c. 160 T > C, p. Phe54Leu) in exon 3 of Txn1.

Proper citation: RRID:RGD_288084580 Copy   


  • RRID:RGD_156430169

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=156430169

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Embryo (as of 2023-02-22)
References:
Synonyms:
Alternate IDs: 156430169
Notes: The MeCP2 KO rat model was originally created at SAGE Labs, Inc. in St. Louis, MO and distributed out of the Boyertown, PA facility. The line continues to be maintained through the original SAGE Labs animal inventory acquired by Envigo. The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Mecp2 into Sprague Dawley embryos. This mutant rat has a knockout of the methyl CpG binding protein 2 (Mecp2). ENVIGO

Proper citation: RRID:RGD_156430169 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155791440

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 155791440
Notes: Immunodeficient subcongenic line developed by intercross SS-Chr 3BN.SS-(D3Rat222-D3Rat218).Il2rgem1Mcwi/Mcwi (RGD:155791433) heterozygous congenic, Il2rg null mutant (X-SCID) lines. Contact MCW rat distribution at [email protected] for availability.

Proper citation: RRID:RGD_155791440 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155269039

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Embryo (as of 2022-10-11)
References:
Synonyms:
Alternate IDs: 155269039
Notes: PCR products of the human H2BC11 (H2B-6), tdTomato, splice acceptor sequence, and IRES-Neor-SV40pA were inserted into the NheI site of prROSA26-1 with an in-fusion cloning kit. The final tdTomato-H2B-6 targeting vector was linearized by SalI digestion. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by electroporation. Targeted ES cells were injected into Crlj:WI (RGD ID: 2312504) blastocysts to produce chimeric rats. The chimeric rats were crossed with Crlj:WI rats to produce heterozygous founder rats.These rat strains are being maintained by crossing the founder rats with Crlj:WI rats. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN

Proper citation: RRID:RGD_155269039 Copy   


  • RRID:RGD_404976873

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=404976873

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2024-03-18)
References:
Synonyms:
Alternate IDs: 404976873
Notes: Four single guide RNAs and SpCas9 targeting sequences CTTCATTGTATGAGCAGCCG, TTTGAAAGAGACAGCTGCCT, ACGCACGTCGGACAGTTCCA, and GGCTTATTGCGCACGCACGT flanking a chromosome 1 region were targeted in SS/JrHsdMcwi embryos. An 82-bp deletion in chromosome 1 (rn7: chr1:255,749,164-255,749,245) resulted. Please contact: [email protected]

Proper citation: RRID:RGD_404976873 Copy   


  • RRID:RGD_5688037

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5688037

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration: (null)
Availability: Unknown
References:
Synonyms:
Alternate IDs: 5688037
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.

Proper citation: RRID:RGD_5688037 Copy   


  • RRID:RGD_5688034

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5688034

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration: (null)
Availability: Live Animals (as of 2017-07-18)
References:
Synonyms:
Alternate IDs: 5688034
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.

Proper citation: RRID:RGD_5688034 Copy   


  • RRID:RGD_405855876

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405855876

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Alternate IDs: 405855876
Notes: This Foxo4 mutant strain was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 2 (target sequence: CCAGATATACGAATGGATGGTCC; nucleotides 517-539) and exon 3 (target sequence: GTTCATCAAGGTACATAACGAGG; nucleotides 631-653) of the Foxo4 gene (NM_001106943.1)) were injected to the embryos to create a 3096-bp deletion including the 3' part of exon 2 and 5' part of exon 3, and resulting a premature stop of the protein.

Proper citation: RRID:RGD_405855876 Copy   


  • RRID:RGD_12790615

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12790615

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Live Animals; Cryorecovery (as of 2017-02-17)
References:
Synonyms:
Alternate IDs: 12790615
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Chrna4 gene of LEW/Crl rat embryos. The resulting mutation is a 4-bp deletion in the Chrna4 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_12790615 Copy   


  • RRID:RGD_6484582

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6484582

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 6484582
Notes: This strain was produced by injecting ZFNs targeting the sequence CTCGCCTGCATCCTTCAAGtgcagtTCCCAGGAGCAGGTAAGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 1.

Proper citation: RRID:RGD_6484582 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. PRECISE-TBI Resources

    Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within PRECISE-TBI that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X